Course Description

Character strings can turn up in all stages of a data science project. You might have to clean messy string input before analysis, extract data that is embedded in text or automatically turn numeric results into a sentence to include in a report. Perhaps the strings themselves are the data of interest, and you need to detect and match patterns within them. This course will help you master these tasks by teaching you how to pull strings apart, put them back together and use stringr to detect, extract, match and split strings using regular expressions, a powerful way to express patterns.

1 String basics

You’ll start with some basics: how to enter strings in R, how to control how numbers are transformed to strings, and finally how to combine strings together to produce output that combines text and nicely formatted numbers.

1.1 Welcome!

1.1.1 Quotes

You can escape quotes inside strings using a backslash.

1.1.2 What you see isn’t always what you have

Take a look at line2

## [1] "\"No room! No room!\" they cried out when they saw Alice \ncoming."

Even though you used single quotes so you didn’t have to escape any double quotes, when R prints it, you’ll see escaped double quotes (\")! R doesn’t care how you defined the string, it only knows what the string represents, in this case, a string with double quotes inside.

When you ask R for line2 it is actually calling print(line2) and the print() method for strings displays strings as you might enter them. If you want to see the string it represents you’ll need to use a different function: writeLines().

## [1] "The table was a large one, but the three were all crowded \ntogether at one corner of it:"                           
## [2] "\"No room! No room!\" they cried out when they saw Alice \ncoming."                                                  
## [3] "\"There's plenty of room!\" said Alice indignantly, \nand she sat down in a large arm-chair at one end of the table."
## The table was a large one, but the three were all crowded 
## together at one corner of it:
## "No room! No room!" they cried out when they saw Alice 
## coming.
## "There's plenty of room!" said Alice indignantly, 
## and she sat down in a large arm-chair at one end of the table.
## The table was a large one, but the three were all crowded 
## together at one corner of it: "No room! No room!" they cried out when they saw Alice 
## coming. "There's plenty of room!" said Alice indignantly, 
## and she sat down in a large arm-chair at one end of the table.
## hello
## 🌍

The function cat() is very similar to writeLines(), but by default separates elements with a space, and will attempt to convert non-character objects to a string. We won’t use it in this course, but you might see it in other people’s code.

1.1.3 Escape sequences

You might have been surprised at the output from the last part of the last exercise. How did you get two lines from one string, and how did you get that little globe? The key is the \.

A sequence in a string that starts with a \is called an escape sequence and allows us to include special characters in our strings. You saw one escape sequence in the first exercise: \" is used to denote a double quote.

In "hello\n\U1F30D" there are two escape sequences: \n gives a newline, and \U followed by up to 8 hex digits sequence denotes a particular Unicode character.

Unicode is a standard for representing characters that might not be on your keyboard. Each available character has a Unicode code point: a number that uniquely identifies it. These code points are generally written in hex notation, that is, using base 16 and the digits 0-9 and A-F. You can find the code point for a particular character by looking up a code chart. If you only need four digits for the codepoint, an alternative escape sequence is \u.

When R comes across a \it assumes you are starting an escape, so if you actually need a backslash in your string you’ll need the sequence \\.

## To have a \ you need \\
## This is a really 
## really 
## really 
## long string
## नमस्ते दुनिया

You can read about a few other escape sequences in the help page ?Quotes.

1.2 Turning numbers into strings

1.2.1 Using format() with numbers

The scientific argument to format() controls whether the numbers are displayed in fixed (scientific = FALSE) or scientific (scientific = TRUE) format.

  • When the representation is scientific, the digits argument is the number of digits before the exponent.
  • When the representation is fixed, digits controls the significant digits used for the smallest (in magnitude) number.
    • Each other number will be formatted to match the number of decimal places in the smallest number.
    • This means the number of decimal places you get in your output depends on all the values you are formatting!

For example, if the smallest number is 0.0011, and digits = 1, then 0.0011 requires 3 places after the decimal to represent it to 1 significant digit, 0.001. Every other number will be formatted to 3 places after the decimal point.

So, how many decimal places will you get if 1.0011 is the smallest number? You’ll find out in this exercise.

## [1] "0.001" "0.011" "1.000"
## [1] "1" "2" "1"
## [1] " 4.0" "-1.9" " 3.0" "-5.0"
## [1] "     72" "   1030" "  10292" "1189192"
## [1] "0.12000000000" "0.98000000000" "0.00001910000" "0.00000000002"

1.2.2 Controlling other aspects of the string

## [1] "     72" "   1030" "  10292" "1189192"
##      72
##    1030
##   10292
## 1189192
## 72
## 1030
## 10292
## 1189192
##        72
##     1,030
##    10,292
## 1,189,192

1.2.3 formatC()

The function formatC() provides an alternative way to format numbers based on C style syntax.

Rather than a scientific argument, formatC() has a format argument that takes a code representing the required format. The most useful are:

  • "f"for fixed,
  • "e" for scientific, and
  • "g" for fixed unless scientific saves space

When using scientific format, the digits argument behaves like it does in format(); it specifies the number of significant digits. However, unlike format(), when using fixed format, digits is the number of digits after the decimal point. This is more predictable than format(), because the number of places after the decimal is fixed regardless of the values being formatted.

formatC() also formats numbers individually, which means you always get the same output regardless of other numbers in the vector.

The flag argument allows you to provide some modifiers that, for example, force the display of the sign (flag = "+"), left align numbers (flag = "-") and pad numbers with leading zeros (flag = "0").

## [1] "0.0" "0.0" "1.0"
## [1] "1.0" "2.0" "1.0"
## [1] "4.0"  "-1.9" "3.0"  "-5.0"
## [1] "+4.0" "-1.9" "+3.0" "-5.0"
## [1] "0.12"    "0.98"    "1.9e-05" "2e-11"

1.3 Putting strings together

1.3.1 Annotation of numbers

## [1] "$72"        "$1,030"     "$10,292"    "$1,189,192"
## [1] "+4.0%" "-1.9%" "+3.0%" "-5.0%"
## [1] "2010: +4.0%,2011: -1.9%,2012: +3.0%,2013: -5.0%"

Specifying sep = "" is so common, there is actually another function paste0() that works like paste() but always pastes elements together without a separator between them.

1.3.2 A very simple table

##           Year 0   $       72
##           Year 1   $    1,030
##           Year 2   $   10,292
## Project Lifetime   $1,189,192

If you wanted the dollar signs right next to the numbers, you could format the incomes with trim = TRUE, paste on the $, then format again as a string with justify = "right".

1.3.3 Let’s order pizza!

## [1] "meatballs" "garlic"    "cheese"
## I want to order a pizza with meatballs, garlic, and cheese.

2 Introduction to stringr

Time to meet stringr! You’ll start by learning about some stringr functions that are very similar to some base R functions, then how to detect specific patterns in strings, how to split strings apart and how to find and replace parts of strings.

2.1 Introducing stringr

2.1.1 Putting strings together with stringr

str_c()

  • the c is short for concatentate, a function that works like paste().
  • It takes vectors of strings as input along with sep and collapse arguments.

There are two key ways str_c() differs from paste().

  • First, the default separator is an empty string, sep = "", as opposed to a space, so it’s more like paste0().
  • handling missing values. paste() turns missing values into the string “NA”, whereas str_c() propagates missing values. That means combining any strings with a missing value will result in another missing value.

This behavior is nice because you learn quickly when you might have missing values, rather than discovering later weird “NA”s inside your strings. Another stringr function that is useful when you may have missing values, is `str_replace_na() which replaces missing values with any string you choose.

2.1.2 String length

`str_length()

  • takes a vector of strings as input and returns the number of characters in each string.
## [1] 5 5

This is very similar to the base function nchar() but str_length() handles factors in an intuitive way, whereas nchar() will just return an error.

## [1] "Noah"    "Liam"    "Mason"   "Jacob"   "William" "Ethan"
## [1] 4 4 5 5 7 5
## [1] 0.3360496
## [1] 4 4 5 5 7 5

The average length of the girls’ names in 2014 is about 1/3 of a character longer. Just be aware this is a naive average where each name is counted once, not weighted by how many babies recevied the name. A better comparison might be an average weighted by the n column in babynames

2.1.3 Extracting substrings

str_sub()

  • extracts parts of strings based on their location.
  • first argument, string, is a vector of strings.
  • The arguments start and end specify the boundaries of the piece to extract in characters.

For example, str_sub(x, 1, 4) asks for the substring starting at the first character, up to the fourth character, or in other words the first four characters. Try it with my Batman’s name:

## [1] "Bruc" "Wayn"

Both start and end can be negative integers, in which case, they count from the end of the string. For example, str_sub(x, -4, -1), asks for the substring starting at the fourth character from the end, up to the first character from the end, i.e. the last four characters. Again, try it with Batman:

## [1] "ruce" "ayne"
## boy_first_letter
##    A    B    C    D    E    F    G    H    I    J    K    L    M    N    O 
## 1450  651  767  996  549  185  332  401  234 1388 1290  536  913  424  207 
##    P    Q    R    S    T    U    V    W    X    Y    Z 
##  230   56  778  804  771   43  160  174   56  252  379
## boy_last_letter
##    a    b    c    d    e    f    g    h    i    j    k    l    m    n    o 
##  421  104   92  436 1145   66   81  582  704   57  349  942  389 4664  729 
##    p    q    r    s    t    u    v    w    x    y    z 
##   32   19 1011  825  291   81   71   34   86  696  119
## girl_first_letter
##    A    B    C    D    E    F    G    H    I    J    K    L    M    N    O 
## 3099  698  941  808  932  209  345  468  373 1429 1689 1121 1744  752  143 
##    P    Q    R    S    T    U    V    W    X    Y    Z 
##  301   38  830 1366  681   28  214   85   62  294  500
## girl_last_letter
##    a    b    c    d    e    f    g    h    i    j    k    l    m    n    o 
## 6624   20   13   81 3111    8   21 1936 1580   12   31  450  115 2600  104 
##    p    q    r    s    t    u    v    w    x    y    z 
##    3    2  291  326  208   59    6   17   49 1432   51
  • "A" is the most popular first letter for both boys and girls, and the most popular last letter for girls.
  • However, the most popular last letter for boys’ names was "n".
  • You might have seen substr() a base R function that is similar to str_sub()
  • The big advantage of str_sub() is the ability to use negative indexes to count from the end of a string.

2.2 Hunting for matches

stringr functions that look for matches

All take a pattern argument

  • str_detect()
  • str_subset()
  • str_count()

2.2.1 Detecting matches

str_detect()

  • answers the question: Does the string contain the pattern?
  • returns a logical vector of the same length as that of the input vector string, with TRUE for elements that contain the pattern and FALSE otherwise.
## [1] FALSE  TRUE  TRUE
##  logi [1:14026] FALSE FALSE FALSE FALSE FALSE FALSE ...
## [1] 16
##  [1] "Uzziah"    "Ozzie"     "Ozzy"      "Uzziel"    "Jazz"     
##  [6] "Chazz"     "Izzy"      "Azzam"     "Izzac"     "Izzak"    
## [11] "Fabrizzio" "Jazziel"   "Azzan"     "Izzaiah"   "Muizz"    
## [16] "Yazziel"
## # A tibble: 16 x 5
##     year sex   name          n       prop
##    <dbl> <chr> <chr>     <int>      <dbl>
##  1  2014 M     Uzziah       67 0.0000328 
##  2  2014 M     Ozzie        62 0.0000304 
##  3  2014 M     Ozzy         57 0.0000279 
##  4  2014 M     Uzziel       21 0.0000103 
##  5  2014 M     Jazz         20 0.00000980
##  6  2014 M     Chazz        17 0.00000833
##  7  2014 M     Izzy         16 0.00000784
##  8  2014 M     Azzam        14 0.00000686
##  9  2014 M     Izzac        13 0.00000637
## 10  2014 M     Izzak         8 0.00000392
## 11  2014 M     Fabrizzio     7 0.00000343
## 12  2014 M     Jazziel       6 0.00000294
## 13  2014 M     Azzan         5 0.00000245
## 14  2014 M     Izzaiah       5 0.00000245
## 15  2014 M     Muizz         5 0.00000245
## 16  2014 M     Yazziel       5 0.00000245

That last example is another common use of str_detect() subsetting a data frame to rows where the values in a column contain the pattern of interest. In this case it lets us see these double-z names are pretty rare. For example, even the most popular, Uzziah, only accounted for 0.003% of boys born in 2014.

2.2.2 Subsetting strings based on match

Since detecting strings with a pattern and then subsetting out those strings is such a common operation, stringr provides a function str_subset() that does that in one step.

For example, let’s repeat our search for “pepper” in our pizzas using str_subset():

## [1] "pepperoni"                 "sausage and green peppers"

We get a new vector of strings, but it only contains those original strings that contained the pattern.

str_subset() can be easily confused with str_extract(). str_extract() returns a vector of the same length as that of the input vector, but with only the parts of the strings that matched the pattern.

##  [1] "Uzziah"    "Ozzie"     "Ozzy"      "Uzziel"    "Jazz"     
##  [6] "Chazz"     "Izzy"      "Azzam"     "Izzac"     "Izzak"    
## [11] "Fabrizzio" "Jazziel"   "Azzan"     "Izzaiah"   "Muizz"    
## [16] "Yazziel"
##  [1] "Izzabella"  "Jazzlyn"    "Jazzlynn"   "Lizzie"     "Izzy"      
##  [6] "Lizzy"      "Mazzy"      "Izzabelle"  "Jazzmine"   "Jazzmyn"   
## [11] "Jazzelle"   "Jazzmin"    "Izzah"      "Jazzalyn"   "Jazzmyne"  
## [16] "Izzabell"   "Jazz"       "Mazzie"     "Alyzza"     "Izza"      
## [21] "Izzie"      "Jazzlene"   "Lizzeth"    "Jazzalynn"  "Jazzy"     
## [26] "Alizzon"    "Elizzabeth" "Jazzilyn"   "Jazzlynne"  "Jizzelle"  
## [31] "Izzabel"    "Izzabellah" "Izzibella"  "Jazzabella" "Jazzabelle"
## [36] "Jazzel"     "Jazzie"     "Jazzlin"    "Jazzlyne"   "Aizza"     
## [41] "Brizza"     "Ezzah"      "Fizza"      "Izzybella"  "Rozzlyn"
##  [1] "Unique"  "Uma"     "Unknown" "Una"     "Uriah"   "Ursula"  "Unity"  
##  [8] "Umaiza"  "Urvi"    "Ulyana"  "Ula"     "Udy"     "Urwa"    "Ulani"  
## [15] "Umaima"  "Umme"    "Ugochi"  "Ulyssa"  "Umika"   "Uriyah"  "Ubah"   
## [22] "Umaira"  "Umi"     "Ume"     "Urenna"  "Uriel"   "Urijah"  "Uyen"
## [1] "Umaiza"

Only one girls’ name that starts with “U” and contains a “z”. Have you ever met an “Umaiza”?

2.2.3 Counting matches

str_count()

  • answers the question “How many times does the pattern occur in each string?”
  • always returns an integer vector of the same length as that of the input vector

If you count the occurrences of "pepper" in your pizzas, you’ll find no occurrences in the first, and one each in the second and third,

## [1] 0 1 1

Perhaps a little more interesing is to count how many "e"s occur in each order

## [1] 3 2 5

## [1] "Aaradhana"

2.3 Splitting strings

2.3.1 Parsing strings into variables

str_split()

  • pull apart raw string data into more useful variables.

In this exercise pull apart a date range, something like "23.01.2017 - 29.01.2017", into separate variables for the start of the range, "23.01.2017", and the end of the range, "29.01.2017".

If the simplify argument is FALSE (the default) you’ll get back a list of the same length as that of the input vector. More commonly, you’ll want to pull out the first piece (or second piece etc.) from every element, which is easier if you specify simplify = TRUE and get a matrix as output.

## [[1]]
## [1] "23.01.2017" "29.01.2017"
## 
## [[2]]
## [1] "30.01.2017" "06.02.2017"
##      [,1]         [,2]        
## [1,] "23.01.2017" "29.01.2017"
## [2,] "30.01.2017" "06.02.2017"
##      [,1] [,2] [,3]  
## [1,] "23" "01" "2017"
## [2,] "30" "01" "2017"

Use the simplify = TRUE argument when you want to split each string into the same number of pieces.

2.3.2 Some simple text statistics

Generally, specifying simplify = TRUE will give you output that is easier to work with, but you’ll always get n pieces (even if some are empty, "").

Sometimes, you want to know how many pieces a string can be split into, or you want to do something with every piece before moving to a simpler structure. This is a situation where you don’t want to simplify and you’ll have to process the output with something like lapply().

As an example, you’ll be performing some simple text statistics on your lines from Alice’s Adventures in Wonderland from Chapter 1. Your goal will be to calculate how many words are in each line, and the average length of words in each line.

To do these calculations, you’ll need to split the lines into words. One way to break a sentence into words is to split on an empty space " ". This is a little naive because, for example, it wouldn’t pick up words separated by a newline escape sequence like in "two\nwords", but since this situation doesn’t occur in your lines, it will do.

## [[1]]
## [1] 18
## 
## [[2]]
## [1] 12
## 
## [[3]]
## [1] 21
## [[1]]
## [1] 3.944444
## 
## [[2]]
## [1] 4.333333
## 
## [[3]]
## [1] 4.428571

The word lengths aren’t quite right because you were including some punctuation symbols. One way to deal with that is to replace them first with str_replace()

2.4 Replacing matches in strings

2.4.1 Replacing to tidy strings

Sometimes, it’s easier to just replace the parts you don’t want with an empty string "". This is also a common strategy to clean strings up, for example, to remove unwanted punctuation or white space.

In this exercise you’ll pull out some numbers by replacing the part of the string that isn’t a number, you’ll also play with the format of some phone numbers. Pay close attention to the difference between str_replace() and str_replace_all().

## [1] "510 555-0123" "541 555-0167"
## [1] "510 555 0123" "541 555 0167"
## [1] "510.555.0123" "541.555.0167"

2.4.2 Review

You’ve covered a lot of stringr functions in this chapter:

  • str_c()
  • str_length()
  • str_sub()
  • str_detect()
  • str_subset()
  • str_count()
  • str_split()
  • str_replace()

As a review we’ve got a few tasks for you to do with some DNA sequences. We’ve put three sequences, corresponding to three genes, from the genome of Yersinia pestis – the bacteria that causes bubonic plague – into the vector genes.

Each string represents a gene, each character a particular nucleotide: Adenine, Cytosine, Guanine or Thymine.

We aren’t going to tell you which function to use. It’s up to you to choose the right one and specify the needed arguments. Good luck!

## [1] 441 462 993
## [1] 118 117 267
## [1] "TTAAGGAACGATCGTACGCATGATAGGGTTTTGCAGTGATATTAGTGTCTCGGTTGACTGGATCTCATCAATAGTCTGGATTTTGTTGATAAGTACCTGCTGCAATGCATCAATGGATTTACACATCACTTTAATAAATATGCTGTAGTGGCCAGTGGTGTAATAGGCCTCAACCACTTCTTCTAAGCTTTCCAATTTTTTCAAGGCGGAAGGGTAATCTTTGGCACTTTTCAAGATTATGCCAATAAAGCAGCAAACGTCGTAACCCAGTTGTTTTGGGTTAACGTGTACACAAGCTGCGGTAATGATCCCTGCTTGCCGCATCTTTTCTACTCTTACATGAATAGTTCCGGGGCTAACAGCGAGGTTTTTGGCTAATTCAGCATAGGGTGTGCGTGCATTTTCCATTAATGCTTTCAGGATGCTGCGATCGAGATTATCGATCTGATAAATTTCACTCAT"
## [1] "TT_G_GT___TT__TCC__TCTTTG_CCC___TCTCTGCTGG_TCCTCTGGT_TTTC_TGTTGG_TG_CGTC__TTTCT__T_TTTC_CCC__CCGTTG_GC_CCTTGTGCG_TC__TTGTTG_TCC_GTTTT_TG_TTGC_CCGC_G___GTGTC_T_TTCTG_GCTGCCT___CC__CCGCCCC___GCGT_CTTGGG_T___TC_GGCTTTTGTTGTTCG_TCTGTTCT__T__TGGCTGC__GTT_TC_GGT_G_TCCCCGGC_CC_TG_GTGG_TGTC_CG_TT__CC_C_GGCC_TTC_GCGT__GTTCGTCC__CTCTGGGCC_TG__GT_TTTCTGT_G____CCC_GCTTCTTCT__TTT_TCCGCT___TGTTC_GC__C_T_TTC_GC_CT_CC__GCGT_CTGCC_CTT_TC__CGTT_TGTC_GCC_T"                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
## [2] "TT__GG__CG_TCGT_CGC_TG_T_GGGTTTTGC_GTG_T_TT_GTGTCTCGGTTG_CTGG_TCTC_TC__T_GTCTGG_TTTTGTTG_T__GT_CCTGCTGC__TGC_TC__TGG_TTT_C_C_TC_CTTT__T___T_TGCTGT_GTGGCC_GTGGTGT__T_GGCCTC__CC_CTTCTTCT__GCTTTCC__TTTTTTC__GGCGG__GGGT__TCTTTGGC_CTTTTC__G_TT_TGCC__T___GC_GC___CGTCGT__CCC_GTTGTTTTGGGTT__CGTGT_C_C__GCTGCGGT__TG_TCCCTGCTTGCCGC_TCTTTTCT_CTCTT_C_TG__T_GTTCCGGGGCT__C_GCG_GGTTTTTGGCT__TTC_GC_T_GGGTGTGCGTGC_TTTTCC_TT__TGCTTTC_GG_TGCTGCG_TCG_G_TT_TCG_TCTG_T___TTTC_CTC_T"                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
## [3] "_TG______C__TTT_TCC_____C__C__C___TC_GCTTCGT____TC_TTCTTTTCCCGCC__TT_G_GC__C__CTTGGCTTG_TCG__GTCC_GGCTCCT_TTTTG_GCCGTGTGGGTG_TGG__CCC__G_T__CCTTTCTGGTTCTG_G___GCGGT_C_GGT____GTT__GTC_TTGCCGG_TTC__CTTTTG__GTTGT_C_TTC_TT_GCG__GTGG___CGT____CCTT_GGGCGTTTTG_TTTTGGTGCTG_CC__GGGGTGT_T_CCC_T_TG___GC_TTGCGCCC_G_TG__G_TCGCCTG_GTGCT_TTC_TTCTGT_T_TGT_G_TC_GTGGG_TTGGG__CGGGTT_TGGGGG_CGGTG__CGT__CCTGGCTT_CCTG___TCG_CTGTT__C__G_TTT_TGC_GCG_TT___G___CTG__GCGGCG_TC_GTGCTG_GTTTGGTGTG__GCCTTTCCTGCCGG_TC_T_TTC_GTTT_TCC_C_GTG___GCCTGCGGGCC_G_TTCCCTG_TTT_G_TGCT___GGCCGTG__CGTGC__TTGCC___G_GTT_GGTGCTGTCTTCCTT_T_GGG_TTGGTGGC___TTGGC_G_TGGTC__TCCC_TG_TGTTCGTGCGCC_G_TT_TG_TG_TTGG_CCTCTCCG_GTGCGG__GGTTTCTCTGG_TT___CGGCG_C_TT_TTGTCTGG__CCC__T_TTGG__G_TGCCTTTG_G_T_TCTTCT_TGGG__TTCGTGTTG_TGCCG__GCTCTT__GCGTC_GTT_GCCCTG_CTGGCG_TG__G_CCGCTTGG__CTGG__TGGC_TC__TC_CTGTTGCGCGGTG___TGCC_C___CT_TCGGGGG_GGT_TTGGTC_GTCCCGCTT_GTG_TGTT_TTGCTGC_G___C__C_T_TTGGTC_GGTGC__TGTGGTGTTTGGGGCCCTG___TC_GCG_G___GTTG_TGGCCTGCTGT__"

2.4.3 Final challenges

As the final exercise we want to expose you to the power of combining operations. You’ll complete two tasks:

  1. You’ll turn a vector of full names, like “Bruce Wayne”, into abbreviated names like “B. Wayne”. This requires combining str_split(), str_sub() and str_c().

  2. You’ll compare how many boy names end in “ee” compared to girl names. This requires combining str_sub() with str_detect() along with the base function table().

## [1] "D. Prince" "C. Kent"
## sex
##   F   M 
## 572  84

3 Pattern matching with regular expressions

In this chapter you’ll learn about regular expressions, a language for describing patterns in strings. By combining regular expressions with the stringr functions you’ll greatly increase your power to manipulate strings.

3.1 Regular expressions

3.1.1 Matching the start or end of the string

rebus provides START and END shortcuts to specify regular expressions that match the start and end of the string. These are also known as anchors. You can try it out just by typing

START

You’ll see the output <regex> ^. The <regex> denotes this is a special regex object and it has the value ^. ^is the character used in the regular expression language to denote the start of a string.

The special operator provided by rebus, %R% allows you to compose complicated regular expressions from simple pieces. When you are reading rebus code, think of %R% as “then”. For example, you could combine START with c,

START %R% "c"

to match the pattern “the start of string then a c”, or in other words: strings that start with c. In `rebus, if you want to match a specific character, or a specific sequence of characters, you simply specify them as a string, e.g. surround them with “.

## <regex> $
  • cat
  • coat
  • scotland
  • tic toc
  • cat
  • coat
  • scotland
  • tic toc
  • cat
  • coat
  • scotland
  • tic toc
  • cat
  • coat
  • scotland
  • tic toc

For that last example, rebus also provides the function exactly(x) which is a shortcut for START %R% x %R% END that matches only if the string is exactly x.

3.1.2 Matching any character

In a regular expression you can use a wildcard to match a single character, no matter what the character is. In rebus it is specified with ANY_CHAR.

## <regex> .

For example, "c" %R% ANY_CHAR %R% "t" will look for patterns like

  • "c_t" where the blank can be any character.
  • Consider the strings:
    • “cat”,
    • “coat”,
    • “scotland” and
    • “tic toc”.

Where would the matches to "c" %R% ANY_CHAR %R% "t" be?

Test your intuition by running:

  • cat
  • coat
  • scotland
  • tic toc

Notice that ANY_CHAR will match a space character (c t in tic toc). It will also match numbers or punctuation symbols, but ANY_CHAR will only ever match one character, which is why we get no match in coat.

  • cat
  • coat
  • scotland
  • tic toc
  • cat
  • coat
  • scotland
  • tic toc
  • cat
  • coat
  • scotland
  • tic toc
  • cat
  • coat
  • scotland
  • tic toc

3.1.3 Combining with stringr functions

You can pass a regular expression as the pattern argument to any stringr function that has the pattern argument.

It now also makes sense to add str_extract() to your repertoire. It returns just the part of the string that matched the pattern:

  • Quentin
  • Kaliq
  • Jacques
  • Jacqes
## [1] 96
## part_with_q
## qa qe qi qm qo qu 
##  1  1  2  2  1 89
## count_of_q
##     0     1 
## 13930    96
## [1] 0.006844432

3.2 More regular expressions

3.2.1 Alternation

The rebus::or() allows us to specify a set of alternatives, which may be single characters or character strings, to be matched. Each alternative is passed as a separate argument.

For example, or("grey", "gray") allows us to detect either the American or British spelling:

  • grey sky
  • gray elephant

Since these two words only differ by one character you could equivalently specify this match with "gr" %R% or("e", "a") %R% "y", that is “a gr followed by, an e or an a, then a y”.

  • Jeffrey
  • Geoffrey
  • Jeffrey
  • Geoffrey
  • Jeffrey
  • Jeffery
  • Geoffrey
  • Jeffry
  • Jefferey
  • Katherine
  • Catherine
  • Kathryn
  • Kathleen
  • Kathy
  • Katharine
  • Katheryn
  • Cathryn
  • Katherin
  • Cathy
  • Kathia
  • Kathrine
  • Cathleen
  • Catharine
  • Katharina
  • Kathya
  • Kathalina
  • Katherina
  • Kathrynn
  • Kathryne
  • Katheryne
  • Kathlyn
  • Cathalina
  • Cathrine
  • Kathaleya
  • Kathie
  • Kathlene
  • Cathaleya
  • Catherina
  • Katherinne
  • Kathlynn
  • Cathalia
  • Catherin
  • Catheryn
  • Kathelyn
  • Kathrynne

3.2.2 Character classes

In regular expressions a character class is a way of specifying “match one (and only one) of the following characters”. In rebus you can specify the set of allowable characters using the function char_class().

This is another way you could specify an alternate spelling, for example, specifying “a gr followed by, either an a or e, followed by a y”:

  • grey sky
  • gray elephant

A negated character class matches “any single character that isn’t one of the following”, and in rebus is specified with negated_char_class().

Unlike in other places in a regular expression you don’t need to escape characters that might otherwise have a special meaning inside character classes. If you want to match . you can include . directly, e.g. char_class("."). Matching a - is a bit trickier. If you need to do it, just make sure it comes first in the character class.

## <regex> [aeiouAEIOU]
  • grey sky
  • gray elephant
  • grey sky
  • gray elephant
## [1] 2.385356
## [1] 0.4000153

The names in boy_names are on average about 40% vowels.

3.2.3 Repetition

The rebus functions one_or_more(), zero_or_more() and optional() can be used to wrap parts of a regular expression to allow a pattern to match a variable number of times.

Take our vowels pattern from the last exercise. You can pass it to one_or_more() to create the pattern that matches “one or more vowels”. Take a look with these interjections:

  • ow
  • ooh
  • yeeeah!
  • shh

You’ll see we can match the single o in ow, the double o in ooh and the string of es followed by the a in yeeeah, but nothing in shh because there isn’t a single vowel.

In contrast zero_or_more() will match even if there isn’t an occurrence, try

  • ow
  • ooh
  • yeeeah!
  • shh

Since both yeeeah and shh start without a vowel, they match “zero vowels”, and since regular expressions are lazy, they look no further and return the start of the string as a match.

  • Io
  • Ty
  • Rhys
  • Flynn
  • Sky
  • Fynn
  • Kyng
  • Cy
  • Wynn
  • Cj
  • Tj
  • Jc
  • Ky
  • Jr
  • Rhythm
  • Rj
  • Md
  • Kc
  • Jj
  • Lynn
  • Rylyn
  • Trygg
  • Dj
  • Jd
  • Kdyn
  • Mj
  • Bryn
  • Lj
  • Tyr
  • Flynt
  • Jb
  • Rylynn
  • Sy
  • Brynn
  • Jdyn
  • Jt
  • Jw
  • Ry
  • Bj
  • Brysyn
  • Kj
  • Lynx
  • Skyy
  • Sylys
  • Trypp
  • Tylynn
  • Hy
  • Jlyn
  • Jp
  • Kylyn
  • Lc
  • Sj
  • Trystyn
  • Tylyn

3.3 Shortcuts

3.3.1 Hunting for phone numbers

  • Call me at 555-555-0191
  • 123 Main St
  • (555) 555 0191
  • Phone: 555.555.0191 Mobile: 555.555.0192
  • Call me at 555-555-0191
  • 123 Main St
  • (555) 555 0191
  • Phone: 555.555.0191 Mobile: 555.555.0192
  • Call me at 555-555-0191
  • 123 Main St
  • (555) 555 0191
  • Phone: 555.555.0191 Mobile: 555.555.0192
  • Call me at 555-555-0191
  • 123 Main St
  • (555) 555 0191
  • Phone: 555.555.0191 Mobile: 555.555.0192
## [1] "555-555-0191"   NA               "(555) 555 0191" "555.555.0191"
## [[1]]
## [1] "555-555-0191"
## 
## [[2]]
## character(0)
## 
## [[3]]
## [1] "(555) 555 0191"
## 
## [[4]]
## [1] "555.555.0191" "555.555.0192"

3.3.2 Extracting age and gender from accident narratives

  • 19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS
  • 31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI
  • ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED
  • TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*
  • 10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB
  • 53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION
  • 13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION
  • 14YR M PLAYING FOOTBALL; DX KNEE SPRAIN
  • 55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE
  • 5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN
  • 19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS
  • 31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI
  • ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED
  • TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*
  • 10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB
  • 53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION
  • 13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION
  • 14YR M PLAYING FOOTBALL; DX KNEE SPRAIN
  • 55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE
  • 5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN
  • 19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS
  • 31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI
  • ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED
  • TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*
  • 10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB
  • 53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION
  • 13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION
  • 14YR M PLAYING FOOTBALL; DX KNEE SPRAIN
  • 55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE
  • 5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN
  • 19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS
  • 31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI
  • ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED
  • TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*
  • 10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB
  • 53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION
  • 13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION
  • 14YR M PLAYING FOOTBALL; DX KNEE SPRAIN
  • 55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE
  • 5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN
##  [1] "19YOM"   "31 YOF"  "82 YOM"  "33 YOF"  "10YOM"   "53 YO F" "13 MOF" 
##  [8] "14YR M"  "55YOM"   "5 YOM"

3.3.3 Parsing age and gender into pieces

4 More advanced matching and manipulation

Now for two advanced ways to use regular expressions along with stringr: selecting parts of a match (a.k.a capturing) and referring back to parts of a match (a.k.a back-referencing). You’ll also learn to deal with and strings or patterns that contain unicode characters (e.g. é).

4.1 Capturing

4.1.1 Capturing parts of a pattern

In rebus, to denote a part of a regular expression you want to capture, you surround it with the function capture(). For example, a simple pattern to match an email address might be,

  • (wolverine@xmen.com)

f you want to capture the part before the @, you simply wrap that part of the regular expression in capture():

  • (wolverine@xmen.com)

The part of the string that matches hasn’t changed, but if we pull out the match with str_match() we get access to the captured piece:

##      [,1]                 [,2]       
## [1,] "wolverine@xmen.com" "wolverine"
  • (wolverine@xmen.com)
  • wonderwoman@justiceleague.org
  • thor@avengers.com
##      [,1]                            [,2]          [,3]            [,4] 
## [1,] "wolverine@xmen.com"            "wolverine"   "xmen"          "com"
## [2,] "wonderwoman@justiceleague.org" "wonderwoman" "justiceleague" "org"
## [3,] "thor@avengers.com"             "thor"        "avengers"      "com"
## [1] "xmen"          "justiceleague" "avengers"

Actually, detecting an email address can be really hard see this discussion for more details.

4.1.2 Pulling out parts of a phone number

## [1] "Call me at 555-555-0191"                 
## [2] "123 Main St"                             
## [3] "(555) 555 0191"                          
## [4] "Phone: 555.555.0191 Mobile: 555.555.0192"
## [1] "(555) 555-0191" NA               "(555) 555-0191" "(555) 555-0191"

If you wanted to extract beyond the first phone number, e.g. The second phone number in the last string, you could use str_match_all(). But, like str_split() it will return a list with one component for each input string, and you’ll need to use lapply() to handle the result.

4.1.3 Extracting age and gender again

##  [1] "19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS "                      
##  [2] "31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI "                                    
##  [3] "ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED "                                      
##  [4] "TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*"            
##  [5] "10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB "                          
##  [6] "53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION "                                      
##  [7] "13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION"
##  [8] "14YR M PLAYING FOOTBALL; DX KNEE SPRAIN "                                                  
##  [9] "55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE "                      
## [10] "5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN"
##       [,1]      [,2] [,3] [,4]
##  [1,] "19YOM"   "19" "YO" "M" 
##  [2,] "31 YOF"  "31" "YO" "F" 
##  [3,] "82 YOM"  "82" "YO" "M" 
##  [4,] "33 YOF"  "33" "YO" "F" 
##  [5,] "10YOM"   "10" "YO" "M" 
##  [6,] "53 YO F" "53" "YO" "F" 
##  [7,] "13 MOF"  "13" "MO" "F" 
##  [8,] "14YR M"  "14" "YR" "M" 
##  [9,] "55YOM"   "55" "YO" "M" 
## [10,] "5 YOM"   "5"  "YO" "M"
  • 19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS
  • 31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI
  • ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED
  • TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*
  • 10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB
  • 53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION
  • 13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION
  • 14YR M PLAYING FOOTBALL; DX KNEE SPRAIN
  • 55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE
  • 5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN
##       [,1]      [,2] [,3] [,4]
##  [1,] "19YOM"   "19" "Y"  "M" 
##  [2,] "31 YOF"  "31" "Y"  "F" 
##  [3,] "82 YOM"  "82" "Y"  "M" 
##  [4,] "33 YOF"  "33" "Y"  "F" 
##  [5,] "10YOM"   "10" "Y"  "M" 
##  [6,] "53 YO F" "53" "Y"  "F" 
##  [7,] "13 MOF"  "13" "M"  "F" 
##  [8,] "14YR M"  "14" "Y"  "M" 
##  [9,] "55YOM"   "55" "Y"  "M" 
## [10,] "5 YOM"   "5"  "Y"  "M"

The combination of capture() and str_match() is powerful for extracting pieces of text.

4.2 Backreferences

4.2.1 Using backreferences in patterns

Backreferences can be useful in matching because they allow you to find repeated patterns or words. Using a backreference requires two things: you need to capture() the part of the pattern you want to reference, and then you refer to it with REF1.

Take a look at this pattern: capture(LOWER) %R% REF1. It matches and captures any lower case character, then is followed by the captured character: it detects repeated characters regardless of what character is repeated. To see it in action try this:

  • hello
  • sweet
  • kitten

If you capture more than one thing you can refer to them with REF2, REF3 etc. up to REF9, counting the captures from the left of the pattern.

  • willliam
  • jedidiah
  • jedediah
  • mamadou
  • didier
  • anand
  • nana
  • talal
  • ananias
  • shahan
  • yochanan
  • anant
  • jalal
  • juanantonio
  • chanan
  • azazel
  • babacar
  • keanan
  • lelend
  • manan
  • kanan
  • ronon
  • elchonon
  • juanangel
  • hanan
  • keenen
  • anan
  • papa
  • yohanan
  • ananth
  • chananya
  • johanan
  • juanandres
  • mamady
  • yaya
  • karar
  • kenenna
  • mamadu
  • nanayaw
  • shahaan
  • vivian
  • william
  • connor
  • emmett
  • bennett
  • jesse
  • kenneth
  • griffin
  • dallas
  • phillip
  • muhammad
  • kellen
  • rocco
  • killian
  • mohammad
  • jefferson
  • otto
  • jeffery
  • callan
  • allan
  • willie
  • terrence
  • hassan
  • apollo
  • terrell
  • konnor
  • emmet
  • pierre
  • rayyan
  • canaan
  • keller
  • kennedy
  • brennen
  • wallace
  • leeland
  • giuseppe
  • finnian
  • ammar
  • jaleel
  • cillian
  • maximillian
  • jimmie
  • willis
  • callahan
  • finnigan
  • abbas
  • everette
  • jerrell
  • abdallah
  • bennet
  • kallan
  • zeppelin
  • riggin
  • leelan
  • nosson
  • brenner
  • finnick
  • jahleel
  • williams
  • brekken
  • dillion
  • riddick
  • kinnick
  • maddax
  • affan
  • dekker
  • renner
  • riggins
  • taggart
  • emmerson
  • maximilliano
  • etienne
  • derrell
  • dillinger
  • kanaan
  • thaddaeus
  • derrek
  • zayyan
  • lavelle
  • cotton
  • maximillion
  • alhassan
  • callaway
  • macallan
  • zakkary
  • bassam
  • jessejames
  • maxamillion
  • tameem
  • jenner
  • joelle
  • tennessee
  • willian
  • jeanpierre
  • kenner
  • greer
  • hammad
  • kenyatta
  • muhammadali
  • dallan
  • issiah
  • welles
  • zaccai
  • ammaar
  • azzam
  • dillian
  • ellery
  • emmerich
  • ghassan
  • kaleel
  • khaleel
  • lafayette
  • donnovan
  • leelynn
  • nissim
  • abdalla
  • billie
  • darragh
  • emilliano
  • griffith
  • jessen
  • kierre
  • leelynd
  • steffen
  • teller
  • vinnie
  • yussuf
  • arran
  • emillio
  • habeeb
  • jerren
  • jerrett
  • kannan
  • kennen
  • million
  • raffaele
  • terrel
  • derreck
  • leelyn
  • ramesses
  • tyrelle
  • abba
  • amillion
  • apollos
  • ayyan
  • callaghan
  • chevelle
  • emmette
  • enner
  • jabbar
  • kelley
  • kenaan
  • kirollos
  • tarrance
  • terren
  • allante
  • cannan
  • dillin
  • edder
  • emmanuelle
  • hattan
  • javelle
  • jefferey
  • johnwilliam
  • marcelle
  • noelle
  • sajjad
  • savva
  • tallan
  • travelle
  • cayenne
  • cheyenne
  • derren
  • fabrizzio
  • gabrielle
  • jarelle
  • jerred
  • liammatthew
  • massai
  • mattan
  • muhannad
  • qassam
  • terrelle
  • abduallah
  • amillio
  • arianna
  • assad
  • bilaal
  • blessed
  • brilliant
  • dayyan
  • elshaddai
  • ferrell
  • fitzwilliam
  • haaheo
  • hassaan
  • illias
  • jaggar
  • jerrel
  • kennet
  • kieffer
  • lassana
  • latrelle
  • leelend
  • lennex
  • menachemmendel
  • morocco
  • romelle
  • schaeffer
  • shammah
  • siddiq
  • tenuun
  • trennen
  • trevelle
  • williamson
  • allah
  • azzan
  • billion
  • caleel
  • common
  • corron
  • emmeric
  • essey
  • finesse
  • garran
  • garrette
  • jamelle
  • jassar
  • jessee
  • joanna
  • jonelle
  • karrar
  • kennett
  • killion
  • leelen
  • leelin
  • markelle
  • marquelle
  • marvelle
  • muhammadamin
  • mukarram
  • raffael
  • rayyaan
  • riddik
  • sirwilliam
  • tannar
  • tyresse
  • vedder
  • zakkai
  • zierre
  • otto
  • abba
  • nosson
  • renner

In addition to matching repeated values, backreferences can also be used for replacement.

4.2.2 Replacing with regular expressions

str_replace() takes three arguments

  • string a vector of strings to do the replacements in,
  • pattern that identifies the parts of strings to replace and
  • replacement the thing to use as a replacement.
    • can be a vector, the same length as string,
    • each element specifies the replacement to be used in each string.
## [1] "Call me at 555-555-0191"                 
## [2] "123 Main St"                             
## [3] "(555) 555 0191"                          
## [4] "Phone: 555.555.0191 Mobile: 555.555.0192"
## [1] "Call me at X55-555-0191"                 
## [2] "X23 Main St"                             
## [3] "(X55) 555 0191"                          
## [4] "Phone: X55.555.0191 Mobile: 555.555.0192"
## [1] "Call me at XXX-XXX-XXXX"                 
## [2] "XXX Main St"                             
## [3] "(XXX) XXX XXXX"                          
## [4] "Phone: XXX.XXX.XXXX Mobile: XXX.XXX.XXXX"
## [1] "Call me at XXX-XXX-XXXX"                 
## [2] "... Main St"                             
## [3] "(***) *** ****"                          
## [4] "Phone: ___.___.____ Mobile: ___.___.____"

Using "" for the replacement value is a great way to cut unwanted bits from a string.

4.2.3 Replacing with backreferences

The replacement argument to str_replace() can also include backreferences. This works just like specifying patterns with backreferences, except the capture happens in the pattern argument, and the backreference is used in the replacement argument.

## [1] "hhello"  "ssweet"  "kkitten"

capture(ANY_CHAR) will match the first character no matter what it is. Then the replacement str_c(REF1, REF1) combines the captured character with itself, in effect doubling the first letter of each string.

  • 19YOM-SHOULDER STRAIN-WAS TACKLED WHILE PLAYING FOOTBALL W/ FRIENDS
  • 31 YOF FELL FROM TOILET HITITNG HEAD SUSTAINING A CHI
  • ANKLE STR. 82 YOM STRAINED ANKLE GETTING OUT OF BED
  • TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*
  • 10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB
  • 53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION
  • 13 MOF TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION
  • 14YR M PLAYING FOOTBALL; DX KNEE SPRAIN
  • 55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE
  • 5 YOM ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN
##  [1] "19YOM-SHOULDER STRAIN-WAS TACKLED WHILE CARELESSLY PLAYING FOOTBALL W/ FRIENDS "                      
##  [2] "31 YOF FELL FROM TOILET HITITNG HEAD CARELESSLY SUSTAINING A CHI "                                    
##  [3] "ANKLE STR. 82 YOM STRAINED ANKLE CARELESSLY GETTING OUT OF BED "                                      
##  [4] "TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*"                       
##  [5] "10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB "                                     
##  [6] "53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION "                                                 
##  [7] "13 MOF CARELESSLY TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION"
##  [8] "14YR M CARELESSLY PLAYING FOOTBALL; DX KNEE SPRAIN "                                                  
##  [9] "55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE "                                 
## [10] "5 YOM CARELESSLY ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN"
##  [1] "19YOM-SHOULDER STRAIN-WAS TACKLED WHILE NEVER PLAYING FOOTBALL W/ FRIENDS "                           
##  [2] "31 YOF FELL FROM TOILET HITITNG HEAD HAPPILY SUSTAINING A CHI "                                       
##  [3] "ANKLE STR. 82 YOM STRAINED ANKLE AFTERWARDS GETTING OUT OF BED "                                      
##  [4] "TRIPPED OVER CAT AND LANDED ON HARDWOOD FLOOR. LACERATION ELBOW, LEFT. 33 YOF*"                       
##  [5] "10YOM CUT THUMB ON METAL TRASH CAN DX AVULSION OF SKIN OF THUMB "                                     
##  [6] "53 YO F TRIPPED ON CARPET AT HOME. DX HIP CONTUSION "                                                 
##  [7] "13 MOF TRUTHFULLY TRYING TO STAND UP HOLDING ONTO BED FELL AND HIT FOREHEAD ON RADIATOR DX LACERATION"
##  [8] "14YR M FERVENTLY PLAYING FOOTBALL; DX KNEE SPRAIN "                                                   
##  [9] "55YOM RIDER OF A BICYCLE AND FELL OFF SUSTAINED A CONTUSION TO KNEE "                                 
## [10] "5 YOM FEROCIOUSLY ROLLING ON FLOOR DOING A SOMERSAULT AND SUSTAINED A CERVICAL STRA IN"

Replacement combined with backreferences can be really useful for reformatting text data.

4.3 Unicode and pattern matching

Smilies

http://unicode.org/charts

http://www.fileformat.info/info/unicode/char/search.htm

## [1] "μ"
## 👏
## 😂
## 😏
## [1] "61"
## [1] "3bc"
## [1] "1f600"
## 😏
## [1] "1f60f"
## 😏

4.3.1 Matching a specific code point or code groups

Things can get tricky when some characters can be specified two ways, for example è, an e with a grave accent, can be specified either with the single code point \u00e8 or the combination of a \u0065 and a combining grave accent \u0300. They look the same:

## è
## è

But, specifying the single code point only matches that version:

  • è
  • è

The stringi package

  • stri_trans_nfc() composes characters with combining accents into a single character.
  • stri_trans_nfd() decomposes character with accents into separate letter and accent characters.

You can see how the characters differ by looking at the hexadecimal codes.

## [1] "065" "300"
## [1] "e8"

In Unicode, an accent is known as a diacritic Unicode Property, and you can match it using the rebus value UP_DIACRITIC.

## [1] "Nguyễn Nhạc"       "Nguyễn Huệ"        "Nguyễn Quang Toản"
## [1] "Nguyễn Nhạc"       "Nguyễn Huệ"        "Nguyễn Quang Toản"
  • Nguyễn Nhạc
  • Nguyễn Huệ
  • Nguyễn Quang Toản

4.3.2 Matching a single grapheme

A related problem is matching a single character. You’ve used ANY_CHAR to do this up until now, but it will only match a character represented by a single code point. Take these three names:

## Adele
## Adèle
## Adèle

They look the similar, but this regular expression only matches two of them:

  • Adele
  • Adèle
  • Adèle

because in the third name è is represented by two code points. The unicode standard has a concept of a grapheme that represents a display character, but may be composed of many code points. To match any grapheme you can use GRAPHEME.

  • Adele
  • Adèle
  • Adèle
## [1] "Nguyễn Nhạc"       "Nguyễn Huệ"        "Nguyễn Quang Toản"
  • Nguyễn Nhạc
  • Nguyễn Huệ
  • Nguyễn Quang Toản
  • Nguyễn Nhạc
  • Nguyễn Huệ
  • Nguyễn Quang Toản
  • Nguyễn Nhạc
  • Nguyễn Huệ
  • Nguyễn Quang Toản

5 Case studies

Practice your string manipulation skills on a couple of case studies. You’ll also learn a few new skills, reading strings into R and handling problems of case (e.g. A versus a).

5.1 A case study, reading a play

5.1.1 Getting the play into R

## FIRST ACT
## 
## 
## SCENE
## 
## 
## Morning-room in Algernon's flat in Half-Moon Street.  The room is
## luxuriously and artistically furnished.  The sound of a piano is heard in
## the adjoining room.
## 
## [Lane is arranging afternoon tea on the table, and after the music has
## ceased, Algernon enters.]
## 
## Algernon.  Did you hear what I was playing, Lane?
## 
## Lane.  I didn't think it polite to listen, sir.
## 
## Algernon.  I'm sorry for that, for your sake.  I don't play
## accurately--any one can play accurately--but I play with wonderful
## expression.  As far as the piano is concerned, sentiment is my forte.  I

5.1.2 Identifying the lines, take 1

The first thing you might notice when you look at your vector play_text is there are lots of empty lines. They don’t really affect your task so you might want to remove them. The easiest way to find empty strings is to use the stringi function stri_isempty(), which returns a logical you can use to subset the not-empty strings:

So, how are you going to find the elements that indicate a character starts their line? Consider the following lines

## [1] "Algernon.  I'm sorry for that, for your sake.  I don't play"             
## [2] "accurately--any one can play accurately--but I play with wonderful"      
## [3] "expression.  As far as the piano is concerned, sentiment is my forte.  I"
## [4] "keep science for Life."                                                  
## [5] "Lane.  Yes, sir."                                                        
## [6] "Algernon.  And, speaking of the science of Life, have you got the"

The first line is for Algernon, the next three strings are continuations of that line, then line 5 is for Lane and line 6 for Algernon.

How about looking for lines that start with a word followed by a .?

  • Algernon. Did you hear what I was playing, Lane?
  • Lane. I didn't think it polite to listen, sir.
  • Algernon. I'm sorry for that, for your sake. I don't play
  • expression. As far as the piano is concerned, sentiment is my forte. I
  • Lane. Yes, sir.
  • Algernon. And, speaking of the science of Life, have you got the
  • Lane. Yes, sir. [Hands them on a salver.]
  • Algernon. [Inspects them, takes two, and sits down on the sofa.] Oh! . . .
  • Lane. Yes, sir; eight bottles and a pint.
  • Algernon. Why is it that at a bachelor's establishment the servants
  • Lane. I attribute it to the superior quality of the wine, sir. I have
  • Algernon. Good heavens! Is marriage so demoralising as that?
  • Lane. I believe it _is_ a very pleasant state, sir. I have had very
  • Algernon. [Languidly_._] I don't know that I am much interested in your
  • Lane. No, sir; it is not a very interesting subject. I never think of
  • Algernon. Very natural, I am sure. That will do, Lane, thank you.
  • Lane. Thank you, sir. [Lane goes out.]
  • Algernon. Lane's views on marriage seem somewhat lax. Really, if the
  • responsibility.
  • Lane. Mr. Ernest Worthing.
  • Algernon. How are you, my dear Ernest? What brings you up to town?
  • Jack. Oh, pleasure, pleasure! What else should bring one anywhere?
  • Algernon. [Stiffly_._] I believe it is customary in good society to
  • Jack. [Sitting down on the sofa.] In the country.
  • Algernon. What on earth do you do there?
  • Jack. [Pulling off his gloves_._] When one is in town one amuses
  • oneself. When one is in the country one amuses other people. It is
  • Algernon. And who are the people you amuse?
  • Jack. [Airily_._] Oh, neighbours, neighbours.
  • Algernon. Got nice neighbours in your part of Shropshire?
  • Jack. Perfectly horrid! Never speak to one of them.
  • Algernon. How immensely you must amuse them! [Goes over and takes
  • sandwich.] By the way, Shropshire is your county, is it not?
  • Jack. Eh? Shropshire? Yes, of course. Hallo! Why all these cups? Why
  • Algernon. Oh! merely Aunt Augusta and Gwendolen.
  • Jack. How perfectly delightful!
  • Algernon. Yes, that is all very well; but I am afraid Aunt Augusta won't
  • Jack. May I ask why?
  • Algernon. My dear fellow, the way you flirt with Gwendolen is perfectly
  • disgraceful. It is almost as bad as the way Gwendolen flirts with you.
  • Jack. I am in love with Gwendolen. I have come up to town expressly to
  • Algernon. I thought you had come up for pleasure? . . . I call that
  • business.
  • Jack. How utterly unromantic you are!
  • Algernon. I really don't see anything romantic in proposing. It is very
  • proposal. Why, one may be accepted. One usually is, I believe. Then
  • Jack. I have no doubt about that, dear Algy. The Divorce Court was
  • constituted.
  • Algernon. Oh! there is no use speculating on that subject. Divorces are
  • Jack. Well, you have been eating them all the time.
  • Algernon. That is quite a different matter. She is my aunt. [Takes
  • Jack. [Advancing to table and helping himself.] And very good bread and
  • Algernon. Well, my dear fellow, you need not eat as if you were going to
  • Jack. Why on earth do you say that?
  • Algernon. Well, in the first place girls never marry the men they flirt
  • with. Girls don't think it right.
  • Jack. Oh, that is nonsense!
  • Algernon. It isn't. It is a great truth. It accounts for the
  • Jack. Your consent!
  • Algernon. My dear fellow, Gwendolen is my first cousin. And before I
  • Cecily. [Rings bell.]
  • Jack. Cecily! What on earth do you mean? What do you mean, Algy, by
  • Algernon. Bring me that cigarette case Mr. Worthing left in the smoking-
  • Lane. Yes, sir. [Lane goes out.]
  • Jack. Do you mean to say you have had my cigarette case all this time? I
  • reward.
  • Algernon. Well, I wish you would offer one. I happen to be more than
  • Jack. There is no good offering a large reward now that the thing is
  • found.
  • once. Lane goes out.]
  • Algernon. I think that is rather mean of you, Ernest, I must say. [Opens
  • Jack. Of course it's mine. [Moving to him.] You have seen me with it a
  • inside. It is a very ungentlemanly thing to read a private cigarette
  • case.
  • Algernon. Oh! it is absurd to have a hard and fast rule about what one
  • Jack. I am quite aware of the fact, and I don't propose to discuss
  • private. I simply want my cigarette case back.
  • Algernon. Yes; but this isn't your cigarette case. This cigarette case
  • Jack. Well, if you want to know, Cecily happens to be my aunt.
  • Algernon. Your aunt!
  • Jack. Yes. Charming old lady she is, too. Lives at Tunbridge Wells.
  • Algernon. [Retreating to back of sofa.] But why does she call herself
  • Jack. [Moving to sofa and kneeling upon it.] My dear fellow, what on
  • herself. You seem to think that every aunt should be exactly like your
  • Algernon. Yes. But why does your aunt call you her uncle? 'From little
  • Ernest.
  • Jack. It isn't Ernest; it's Jack.
  • Algernon. You have always told me it was Ernest. I have introduced you
  • Ernest. It's on your cards. Here is one of them. [Taking it from
  • case.] 'Mr. Ernest Worthing, B. 4, The Albany.' I'll keep this as a
  • Jack. Well, my name is Ernest in town and Jack in the country, and the
  • Algernon. Yes, but that does not account for the fact that your small
  • Jack. My dear Algy, you talk exactly as if you were a dentist. It is
  • Algernon. Well, that is exactly what dentists always do. Now, go on!
  • now.
  • Jack. Bunburyist? What on earth do you mean by a Bunburyist?
  • Algernon. I'll reveal to you the meaning of that incomparable expression
  • Jack. Well, produce my cigarette case first.
  • Algernon. Here it is. [Hands cigarette case.] Now produce your
  • Jack. My dear fellow, there is nothing improbable about my explanation
  • Algernon. Where is that place in the country, by the way?
  • Jack. That is nothing to you, dear boy. You are not going to be invited
  • Algernon. I suspected that, my dear fellow! I have Bunburyed all over
  • Jack. My dear Algy, I don't know whether you will be able to understand
  • subjects. It's one's duty to do so. And as a high moral tone can hardly
  • simple.
  • Algernon. The truth is rarely pure and never simple. Modern life would
  • Jack. That wouldn't be at all a bad thing.
  • Algernon. Literary criticism is not your forte, my dear fellow. Don't
  • University. They do it so well in the daily papers. What you really are
  • Jack. What on earth do you mean?
  • Algernon. You have invented a very useful younger brother called Ernest,
  • week.
  • Jack. I haven't asked you to dine with me anywhere to-night.
  • Algernon. I know. You are absurdly careless about sending out
  • invitations. It is very foolish of you. Nothing annoys people so much
  • Jack. You had much better dine with your Aunt Augusta.
  • Algernon. I haven't the smallest intention of doing anything of the
  • kind. To begin with, I dined there on Monday, and once a week is quite
  • scandalous. It looks so bad. It is simply washing one's clean linen in
  • public. Besides, now that I know you to be a confirmed Bunburyist I
  • rules.
  • Jack. I'm not a Bunburyist at all. If Gwendolen accepts me, I am going
  • Algernon. Nothing will induce me to part with Bunbury, and if you ever
  • Jack. That is nonsense. If I marry a charming girl like Gwendolen, and
  • Algernon. Then your wife will. You don't seem to realise, that in
  • Jack. [Sententiously.] That, my dear young friend, is the theory that
  • Algernon. Yes; and that the happy English home has proved in half the
  • time.
  • Jack. For heaven's sake, don't try to be cynical. It's perfectly easy
  • Algernon. My dear fellow, it isn't easy to be anything nowadays. There's
  • Jack. I suppose so, if you want to.
  • Algernon. Yes, but you must be serious about it. I hate people who are
  • Lane. Lady Bracknell and Miss Fairfax.
  • Gwendolen.]
  • Algernon. I'm feeling very well, Aunt Augusta.
  • Algernon. [To Gwendolen.] Dear me, you are smart!
  • Gwendolen. I am always smart! Am I not, Mr. Worthing?
  • Jack. You're quite perfect, Miss Fairfax.
  • Gwendolen. Oh! I hope I am not that. It would leave no room for
  • Algernon. Certainly, Aunt Augusta. [Goes over to tea-table.]
  • Gwendolen. Thanks, mamma, I'm quite comfortable where I am.
  • Algernon. [Picking up empty plate in horror.] Good heavens! Lane! Why
  • Lane. [Gravely.] There were no cucumbers in the market this morning,
  • sir. I went down twice.
  • Algernon. No cucumbers!
  • Lane. No, sir. Not even for ready money.
  • Algernon. That will do, Lane, thank you.
  • Lane. Thank you, sir. [Goes out.]
  • Algernon. I am greatly distressed, Aunt Augusta, about there being no
  • Algernon. I hear her hair has turned quite gold from grief.
  • Algernon. I am afraid, Aunt Augusta, I shall have to give up the
  • Algernon. It is a great bore, and, I need hardly say, a terrible
  • Jack.] They seem to think I should be with him.
  • Algernon. Yes; poor Bunbury is a dreadful invalid.
  • Algernon. I'll speak to Bunbury, Aunt Augusta, if he is still conscious,
  • allow. People always seem to think that they are improper, and either
  • Gwendolen. Certainly, mamma.
  • behind.]
  • Jack. Charming day it has been, Miss Fairfax.
  • Gwendolen. Pray don't talk to me about the weather, Mr. Worthing.
  • Jack. I do mean something else.
  • Gwendolen. I thought so. In fact, I am never wrong.
  • Jack. And I would like to be allowed to take advantage of Lady
  • Gwendolen. I would certainly advise you to do so. Mamma has a way of
  • about.
  • Jack. [Nervously.] Miss Fairfax, ever since I met you I have admired
  • Gwendolen. Yes, I am quite well aware of the fact. And I often wish
  • you.
  • Jack. You really love me, Gwendolen?
  • Gwendolen. Passionately!
  • Jack. Darling! You don't know how happy you've made me.
  • Gwendolen. My own Ernest!
  • Jack. But you don't really mean to say that you couldn't love me if my
  • Gwendolen. But your name is Ernest.
  • Jack. Yes, I know it is. But supposing it was something else? Do you
  • Gwendolen. [Glibly.] Ah! that is clearly a metaphysical speculation,
  • Jack. Personally, darling, to speak quite candidly, I don't much care
  • Gwendolen. It suits you perfectly. It is a divine name. It has a music
  • Jack. Well, really, Gwendolen, I must say that I think there are lots of
  • Gwendolen. Jack? . . . No, there is very little music in the name Jack,
  • Ernest.
  • Jack. Gwendolen, I must get christened at once--I mean we must get
  • Gwendolen. Married, Mr. Worthing?
  • Jack. [Astounded.] Well . . . surely. You know that I love you, and
  • Gwendolen. I adore you. But you haven't proposed to me yet. Nothing
  • Jack. Well . . . may I propose to you now?
  • Gwendolen. I think it would be an admirable opportunity. And to spare
  • you.
  • Jack. Gwendolen!
  • Gwendolen. Yes, Mr. Worthing, what have you got to say to me?
  • Jack. You know what I have got to say to you.
  • Gwendolen. Yes, but you don't say it.
  • Jack. Gwendolen, will you marry me? [Goes on his knees.]
  • Gwendolen. Of course I will, darling. How long you have been about it!
  • Jack. My own one, I have never loved any one in the world but you.
  • Gwendolen. Yes, but men often propose for practice. I know my brother
  • present. [Enter Lady Bracknell.]
  • posture. It is most indecorous.
  • Gwendolen. Mamma! [He tries to rise; she restrains him.] I must beg
  • Gwendolen. I am engaged to Mr. Worthing, mamma. [They rise together.]
  • carriage.
  • Gwendolen. [Reproachfully.] Mamma!
  • door. She and Jack blow kisses to each other behind Lady Bracknell's
  • back. Lady Bracknell looks vaguely about as if she could not understand
  • Gwendolen. Yes, mamma. [Goes out, looking back at Jack.]
  • Jack. Thank you, Lady Bracknell, I prefer standing.
  • Jack. Well, yes, I must admit I smoke.
  • is. How old are you?
  • Jack. Twenty-nine.
  • Jack. [After some hesitation.] I know nothing, Lady Bracknell.
  • Jack. Between seven and eight thousand a year.
  • Jack. In investments, chiefly.
  • Jack. I have a country house with some land, of course, attached to it,
  • Jack. Well, I own a house in Belgrave Square, but it is let by the year
  • Jack. Oh, she goes about very little. She is a lady considerably
  • character. What number in Belgrave Square?
  • Jack. 149.
  • Jack. Do you mean the fashion, or the side?
  • Jack. Well, I am afraid I really have none. I am a Liberal Unionist.
  • Jack. I have lost both my parents.
  • Jack. I am afraid I really don't know. The fact is, Lady Bracknell, I
  • birth. I was . . . well, I was found.
  • Jack. The late Mr. Thomas Cardew, an old gentleman of a very charitable
  • resort.
  • Jack. [Gravely.] In a hand-bag.
  • Jack. [Very seriously.] Yes, Lady Bracknell. I was in a hand-bag--a
  • Jack. In the cloak-room at Victoria Station. It was given to him in
  • Jack. Yes. The Brighton line.
  • Jack. May I ask you then what you would advise me to do? I need hardly
  • Jack. Well, I don't see how I could possibly manage to do that. I can
  • Jack. Good morning! [Algernon, from the other room, strikes up the
  • Algernon. Didn't it go off all right, old boy? You don't mean to say
  • Jack. Oh, Gwendolen is as right as a trivet. As far as she is
  • you.
  • Algernon. My dear boy, I love hearing my relations abused. It is the
  • Jack. Oh, that is nonsense!
  • Algernon. It isn't!
  • Jack. Well, I won't argue about the matter. You always want to argue
  • Algernon. That is exactly what things were originally made for.
  • Jack. Upon my word, if I thought that, I'd shoot myself . . . [A pause.]
  • Algernon. All women become like their mothers. That is their tragedy.
  • Jack. Is that clever?
  • Algernon. It is perfectly phrased! and quite as true as any observation
  • Jack. I am sick to death of cleverness. Everybody is clever nowadays.
  • Algernon. We have.
  • Jack. I should extremely like to meet them. What do they talk about?
  • Algernon. The fools? Oh! about the clever people, of course.
  • Jack. What fools!
  • Algernon. By the way, did you tell Gwendolen the truth about your being
  • Jack. [In a very patronising manner.] My dear fellow, the truth isn't
  • Algernon. The only way to behave to a woman is to make love to her, if
  • Jack. Oh, that is nonsense.
  • Algernon. What about your brother? What about the profligate Ernest?
  • Jack. Oh, before the end of the week I shall have got rid of him. I'll
  • Algernon. Yes, but it's hereditary, my dear fellow. It's a sort of
  • Jack. You are sure a severe chill isn't hereditary, or anything of that
  • Algernon. Of course it isn't!
  • Jack. Very well, then. My poor brother Ernest to carried off suddenly,
  • Algernon. But I thought you said that . . . Miss Cardew was a little too
  • Jack. Oh, that is all right. Cecily is not a silly romantic girl, I am
  • Algernon. I would rather like to see Cecily.
  • Jack. I will take very good care you never do. She is excessively
  • Algernon. Have you told Gwendolen yet that you have an excessively
  • Jack. Oh! one doesn't blurt these things out to people. Cecily and
  • Algernon. Women only do that when they have called each other a lot of
  • Jack. [Irritably.] Oh! It always is nearly seven.
  • Algernon. Well, I'm hungry.
  • Jack. I never knew you when you weren't . . .
  • Algernon. What shall we do after dinner? Go to a theatre?
  • Jack. Oh no! I loathe listening.
  • Algernon. Well, let us go to the Club?
  • Jack. Oh, no! I hate talking.
  • Algernon. Well, we might trot round to the Empire at ten?
  • Jack. Oh, no! I can't bear looking at things. It is so silly.
  • Algernon. Well, what shall we do?
  • Jack. Nothing!
  • Algernon. It is awfully hard work doing nothing. However, I don't mind
  • Lane. Miss Fairfax.
  • Algernon. Gwendolen, upon my word!
  • Gwendolen. Algy, kindly turn your back. I have something very
  • Algernon. Really, Gwendolen, I don't think I can allow this at all.
  • Gwendolen. Algy, you always adopt a strictly immoral attitude towards
  • life. You are not quite old enough to do that. [Algernon retires to the
  • fireplace.]
  • Jack. My own darling!
  • Gwendolen. Ernest, we may never be married. From the expression on
  • Jack. Dear Gwendolen!
  • Gwendolen. The story of your romantic origin, as related to me by mamma,
  • nature. Your Christian name has an irresistible fascination. The
  • me. Your town address at the Albany I have. What is your address in the
  • Jack. The Manor House, Woolton, Hertfordshire.
  • Gwendolen. There is a good postal service, I suppose? It may be
  • consideration. I will communicate with you daily.
  • Jack. My own one!
  • Gwendolen. How long do you remain in town?
  • Jack. Till Monday.
  • Gwendolen. Good! Algy, you may turn round now.
  • Algernon. Thanks, I've turned round already.
  • Gwendolen. You may also ring the bell.
  • Jack. You will let me see you to your carriage, my own darling?
  • Gwendolen. Certainly.
  • Jack. [To Lane, who now enters.] I will see Miss Fairfax out.
  • Lane. Yes, sir. [Jack and Gwendolen go off.]
  • Algernon. A glass of sherry, Lane.
  • Lane. Yes, sir.
  • Algernon. To-morrow, Lane, I'm going Bunburying.
  • Lane. Yes, sir.
  • Algernon. I shall probably not be back till Monday. You can put up my
  • Lane. Yes, sir. [Handing sherry.]
  • Algernon. I hope to-morrow will be a fine day, Lane.
  • Lane. It never is, sir.
  • Algernon. Lane, you're a perfect pessimist.
  • Lane. I do my best to give satisfaction, sir.
  • Jack. There's a sensible, intellectual girl! the only girl I ever cared
  • Algernon. Oh, I'm a little anxious about poor Bunbury, that is all.
  • Jack. If you don't take care, your friend Bunbury will get you into a
  • Algernon. I love scrapes. They are the only things that are never
  • serious.
  • Jack. Oh, that's nonsense, Algy. You never talk anything but nonsense.
  • Algernon. Nobody ever does.
  • house. The garden, an old-fashioned one, full of roses. Time of year,
  • July. Basket chairs, and a table covered with books, are set under a
  • Cecily. [Coming over very slowly.] But I don't like German. It isn't
  • Cecily. Dear Uncle Jack is so very serious! Sometimes he is so serious
  • Cecily. I suppose that is why he often looks a little bored when we
  • Cecily. I wish Uncle Jack would allow that unfortunate young man, his
  • Cecily. I keep a diary in order to enter the wonderful secrets of my
  • life. If I didn't write them down, I should probably forget all about
  • them.
  • Cecily. Yes, but it usually chronicles the things that have never
  • Cecily. Did you really, Miss Prism? How wonderfully clever you are! I
  • Cecily. I suppose so. But it seems very unfair. And was your novel
  • Cecily. [Smiling.] But I see dear Dr. Chasuble coming up through the
  • garden.
  • pleasure.
  • Chasuble. And how are we this morning? Miss Prism, you are, I trust,
  • Cecily. Miss Prism has just been complaining of a slight headache. I
  • Cecily. No, dear Miss Prism, I know that, but I felt instinctively that
  • Chasuble. I hope, Cecily, you are not inattentive.
  • Cecily. Oh, I am afraid I am.
  • Chasuble. That is strange. Were I fortunate enough to be Miss Prism's
  • metaphorically.--My metaphor was drawn from bees. Ahem! Mr. Worthing, I
  • Chasuble. Ah yes, he usually likes to spend his Sunday in London. He is
  • Chasuble. [Bowing.] A classical allusion merely, drawn from the Pagan
  • authors. I shall see you both no doubt at Evensong?
  • Chasuble. With pleasure, Miss Prism, with pleasure. We might go as far
  • Cecily. [Picks up books and throws them back on table.] Horrid
  • Merriman. Mr. Ernest Worthing has just driven over from the station. He
  • Cecily. [Takes the card and reads it.] 'Mr. Ernest Worthing, B. 4, The
  • Merriman. Yes, Miss. He seemed very much disappointed. I mentioned
  • Cecily. Ask Mr. Ernest Worthing to come here. I suppose you had better
  • Merriman. Yes, Miss.
  • Cecily. I have never met any really wicked person before. I feel rather
  • frightened. I am so afraid he will look just like every one else.
  • Algernon. [Raising his hat.] You are my little cousin Cecily, I'm sure.
  • Cecily. You are under some strange mistake. I am not little. In fact,
  • Algernon. Oh! I am not really wicked at all, cousin Cecily. You mustn't
  • Cecily. If you are not, then you have certainly been deceiving us all in
  • Algernon. [Looks at her in amazement.] Oh! Of course I have been
  • Cecily. I am glad to hear it.
  • Algernon. In fact, now you mention the subject, I have been very bad in
  • Cecily. I don't think you should be so proud of that, though I am sure
  • Algernon. It is much pleasanter being here with you.
  • Cecily. I can't understand how you are here at all. Uncle Jack won't be
  • Algernon. That is a great disappointment. I am obliged to go up by the
  • Cecily. Couldn't you miss it anywhere but in London?
  • Algernon. No: the appointment is in London.
  • Cecily. Well, I know, of course, how important it is not to keep a
  • Algernon. About my what?
  • Cecily. Your emigrating. He has gone up to buy your outfit.
  • Algernon. I certainly wouldn't let Jack buy my outfit. He has no taste
  • Cecily. I don't think you will require neckties. Uncle Jack is sending
  • Algernon. Australia! I'd sooner die.
  • Cecily. Well, he said at dinner on Wednesday night, that you would have
  • Algernon. Oh, well! The accounts I have received of Australia and the
  • Cecily. Yes, but are you good enough for it?
  • Algernon. I'm afraid I'm not that. That is why I want you to reform me.
  • Cecily. I'm afraid I've no time, this afternoon.
  • Algernon. Well, would you mind my reforming myself this afternoon?
  • Cecily. It is rather Quixotic of you. But I think you should try.
  • Algernon. I will. I feel better already.
  • Cecily. You are looking a little worse.
  • Algernon. That is because I am hungry.
  • Cecily. How thoughtless of me. I should have remembered that when one
  • meals. Won't you come in?
  • Algernon. Thank you. Might I have a buttonhole first? I never have any
  • Cecily. A Marechal Niel? [Picks up scissors.]
  • Algernon. No, I'd sooner have a pink rose.
  • Cecily. Why? [Cuts a flower.]
  • Algernon. Because you are like a pink rose, Cousin Cecily.
  • Cecily. I don't think it can be right for you to talk to me like that.
  • Algernon. Then Miss Prism is a short-sighted old lady. [Cecily puts the
  • Cecily. Miss Prism says that all good looks are a snare.
  • Algernon. They are a snare that every sensible man would like to be
  • Cecily. Oh, I don't think I would care to catch a sensible man. I
  • married. A misanthrope I can understand--a womanthrope, never!
  • Chasuble. [With a scholar's shudder.] Believe me, I do not deserve so
  • Chasuble. But is a man not equally attractive when married?
  • Chasuble. And often, I've been told, not even to her.
  • Chasuble. Perhaps she followed us to the schools.
  • Chasuble. Mr. Worthing?
  • Jack. [Shakes Miss Prism's hand in a tragic manner.] I have returned
  • Chasuble. Dear Mr. Worthing, I trust this garb of woe does not betoken
  • Jack. My brother.
  • Chasuble. Still leading his life of pleasure?
  • Jack. [Shaking his head.] Dead!
  • Chasuble. Your brother Ernest dead?
  • Jack. Quite dead.
  • Chasuble. Mr. Worthing, I offer you my sincere condolence. You have at
  • Jack. Poor Ernest! He had many faults, but it is a sad, sad blow.
  • Chasuble. Very sad indeed. Were you with him at the end?
  • Jack. No. He died abroad; in Paris, in fact. I had a telegram last
  • Chasuble. Was the cause of death mentioned?
  • Jack. A severe chill, it seems.
  • Chasuble. [Raising his hand.] Charity, dear Miss Prism, charity! None
  • Jack. No. He seems to have expressed a desire to be buried in Paris.
  • Chasuble. In Paris! [Shakes his head.] I fear that hardly points to
  • Sunday. [Jack presses his hand convulsively.] My sermon on the meaning
  • Jack. Ah! that reminds me, you mentioned christenings I think, Dr.
  • subject. But they don't seem to know what thrift is.
  • Chasuble. But is there any particular infant in whom you are interested,
  • Mr. Worthing? Your brother was, I believe, unmarried, was he not?
  • Jack. Oh yes.
  • are.
  • Jack. But it is not for any child, dear Doctor. I am very fond of
  • children. No! the fact is, I would like to be christened myself, this
  • Chasuble. But surely, Mr. Worthing, you have been christened already?
  • Jack. I don't remember anything about it.
  • Chasuble. But have you any grave doubts on the subject?
  • Jack. I certainly intend to have. Of course I don't know if the thing
  • Chasuble. Not at all. The sprinkling, and, indeed, the immersion of
  • Jack. Immersion!
  • Chasuble. You need have no apprehensions. Sprinkling is all that is
  • Jack. Oh, I might trot round about five if that would suit you.
  • Chasuble. Perfectly, perfectly! In fact I have two similar ceremonies
  • Jack. Oh! I don't see much fun in being christened along with other
  • babies. It would be childish. Would half-past five do?
  • Chasuble. Admirably! Admirably! [Takes out watch.] And now, dear Mr.
  • Cecily. Uncle Jack! Oh, I am pleased to see you back. But what horrid
  • Chasuble. My child! my child! [Cecily goes towards Jack; he kisses her
  • Cecily. What is the matter, Uncle Jack? Do look happy! You look as if
  • Jack. Who?
  • Cecily. Your brother Ernest. He arrived about half an hour ago.
  • Jack. What nonsense! I haven't got a brother.
  • Cecily. Oh, don't say that. However badly he may have behaved to you in
  • Chasuble. These are very joyful tidings.
  • Jack. My brother is in the dining-room? I don't know what it all means.
  • Jack. Good heavens! [Motions Algernon away.]
  • Algernon. Brother John, I have come down from town to tell you that I am
  • Cecily. Uncle Jack, you are not going to refuse your own brother's hand?
  • Jack. Nothing will induce me to take his hand. I think his coming down
  • Cecily. Uncle Jack, do be nice. There is some good in every one. Ernest
  • Jack. Oh! he has been talking about Bunbury, has he?
  • Cecily. Yes, he has told me all about poor Mr. Bunbury, and his terrible
  • Jack. Bunbury! Well, I won't have him talk to you about Bunbury or
  • Algernon. Of course I admit that the faults were all on my side. But I
  • painful. I expected a more enthusiastic welcome, especially considering
  • Cecily. Uncle Jack, if you don't shake hands with Ernest I will never
  • Jack. Never forgive me?
  • Cecily. Never, never, never!
  • Jack. Well, this is the last time I shall ever do it. [Shakes with
  • Chasuble. It's pleasant, is it not, to see so perfect a reconciliation?
  • Cecily. Certainly, Miss Prism. My little task of reconciliation is
  • over.
  • Chasuble. You have done a beautiful action to-day, dear child.
  • Cecily. I feel very happy. [They all go off except Jack and Algernon.]
  • Jack. You young scoundrel, Algy, you must get out of this place as soon
  • Merriman. I have put Mr. Ernest's things in the room next to yours, sir.
  • Jack. What?
  • Merriman. Mr. Ernest's luggage, sir. I have unpacked it and put it in
  • Jack. His luggage?
  • Merriman. Yes, sir. Three portmanteaus, a dressing-case, two hat-boxes,
  • Algernon. I am afraid I can't stay more than a week this time.
  • Jack. Merriman, order the dog-cart at once. Mr. Ernest has been
  • Merriman. Yes, sir. [Goes back into the house.]
  • Algernon. What a fearful liar you are, Jack. I have not been called
  • Jack. Yes, you have.
  • Algernon. I haven't heard any one call me.
  • Jack. Your duty as a gentleman calls you back.
  • Algernon. My duty as a gentleman has never interfered with my pleasures
  • Jack. I can quite understand that.
  • Algernon. Well, Cecily is a darling.
  • Jack. You are not to talk of Miss Cardew like that. I don't like it.
  • Algernon. Well, I don't like your clothes. You look perfectly
  • grotesque.
  • Jack. You are certainly not staying with me for a whole week as a guest
  • Algernon. I certainly won't leave you so long as you are in mourning. It
  • Jack. Well, will you go if I change my clothes?
  • Algernon. Yes, if you are not too long. I never saw anybody take so
  • Jack. Well, at any rate, that is better than being always over-dressed
  • Algernon. If I am occasionally a little over-dressed, I make up for it
  • Jack. Your vanity is ridiculous, your conduct an outrage, and your
  • Algernon. I think it has been a great success. I'm in love with Cecily,
  • Cecily. Oh, I merely came back to water the roses. I thought you were
  • Algernon. He's gone to order the dog-cart for me.
  • Cecily. Oh, is he going to take you for a nice drive?
  • Algernon. He's going to send me away.
  • Cecily. Then have we got to part?
  • Algernon. I am afraid so. It's a very painful parting.
  • Cecily. It is always painful to part from people whom one has known for
  • Algernon. Thank you.
  • Merriman. The dog-cart is at the door, sir. [Algernon looks appealingly
  • Cecily. It can wait, Merriman for . . . five minutes.
  • Merriman. Yes, Miss. [Exit Merriman.]
  • Algernon. I hope, Cecily, I shall not offend you if I state quite
  • Cecily. I think your frankness does you great credit, Ernest. If you
  • Algernon. Do you really keep a diary? I'd give anything to look at it.
  • Cecily. Oh no. [Puts her hand over it.] You see, it is simply a very
  • Algernon. [Somewhat taken aback.] Ahem! Ahem!
  • Cecily. Oh, don't cough, Ernest. When one is dictating one should speak
  • Algernon. [Speaking very rapidly.] Cecily, ever since I first looked
  • Cecily. I don't think that you should tell me that you love me wildly,
  • Algernon. Cecily!
  • Merriman. The dog-cart is waiting, sir.
  • Algernon. Tell it to come round next week, at the same hour.
  • Merriman. [Looks at Cecily, who makes no sign.] Yes, sir.
  • Cecily. Uncle Jack would be very much annoyed if he knew you were
  • Algernon. Oh, I don't care about Jack. I don't care for anybody in the
  • Cecily. You silly boy! Of course. Why, we have been engaged for the
  • Algernon. For the last three months?
  • Cecily. Yes, it will be exactly three months on Thursday.
  • Algernon. But how did we become engaged?
  • Cecily. Well, ever since dear Uncle Jack first confessed to us that he
  • Algernon. Darling! And when was the engagement actually settled?
  • Cecily. On the 14th of February last. Worn out by your entire ignorance
  • here. The next day I bought this little ring in your name, and this is
  • wear.
  • Algernon. Did I give you this? It's very pretty, isn't it?
  • Cecily. Yes, you've wonderfully good taste, Ernest. It's the excuse
  • Algernon. My letters! But, my own sweet Cecily, I have never written
  • Cecily. You need hardly remind me of that, Ernest. I remember only too
  • Algernon. Oh, do let me read them, Cecily?
  • Cecily. Oh, I couldn't possibly. They would make you far too conceited.
  • Algernon. But was our engagement ever broken off?
  • Cecily. Of course it was. On the 22nd of last March. You can see the
  • Ernest. I feel it is better to do so. The weather still continues
  • charming.'
  • Algernon. But why on earth did you break it off? What had I done? I
  • Cecily. It would hardly have been a really serious engagement if it
  • Algernon. [Crossing to her, and kneeling.] What a perfect angel you
  • Cecily. You dear romantic boy. [He kisses her, she puts her fingers
  • Algernon. Yes, darling, with a little help from others.
  • Cecily. I am so glad.
  • Algernon. You'll never break off our engagement again, Cecily?
  • Cecily. I don't think I could break it off now that I have actually met
  • you. Besides, of course, there is the question of your name.
  • Algernon. Yes, of course. [Nervously.]
  • Cecily. You must not laugh at me, darling, but it had always been a
  • Algernon. But, my dear child, do you mean to say you could not love me
  • Cecily. But what name?
  • Algernon. Oh, any name you like--Algernon--for instance . . .
  • Cecily. But I don't like the name of Algernon.
  • Algernon. Well, my own dear, sweet, loving little darling, I really
  • Cecily. [Rising.] I might respect you, Ernest, I might admire your
  • attention.
  • Algernon. Ahem! Cecily! [Picking up hat.] Your Rector here is, I
  • Cecily. Oh, yes. Dr. Chasuble is a most learned man. He has never
  • Algernon. I must see him at once on a most important christening--I mean
  • Cecily. Oh!
  • Algernon. I shan't be away more than half an hour.
  • Cecily. Considering that we have been engaged since February the 14th,
  • Algernon. I'll be back in no time.
  • Cecily. What an impetuous boy he is! I like his hair so much. I must
  • Merriman. A Miss Fairfax has just called to see Mr. Worthing. On very
  • Cecily. Isn't Mr. Worthing in his library?
  • Merriman. Mr. Worthing went over in the direction of the Rectory some
  • Cecily. Pray ask the lady to come out here; Mr. Worthing is sure to be
  • Merriman. Yes, Miss. [Goes out.]
  • Cecily. Miss Fairfax! I suppose one of the many good elderly women who
  • London. I don't quite like women who are interested in philanthropic
  • work. I think it is so forward of them.
  • Merriman. Miss Fairfax.
  • Cecily. [Advancing to meet her.] Pray let me introduce myself to you.
  • Gwendolen. Cecily Cardew? [Moving to her and shaking hands.] What a
  • friends. I like you already more than I can say. My first impressions
  • Cecily. How nice of you to like me so much after we have known each
  • Gwendolen. [Still standing up.] I may call you Cecily, may I not?
  • Cecily. With pleasure!
  • Gwendolen. And you will always call me Gwendolen, won't you?
  • Cecily. If you wish.
  • Gwendolen. Then that is all quite settled, is it not?
  • Cecily. I hope so. [A pause. They both sit down together.]
  • Gwendolen. Perhaps this might be a favourable opportunity for my
  • Cecily. I don't think so.
  • Gwendolen. Outside the family circle, papa, I am glad to say, is
  • Cecily. Oh! not at all, Gwendolen. I am very fond of being looked at.
  • Gwendolen. [After examining Cecily carefully through a lorgnette.] You
  • Cecily. Oh no! I live here.
  • Gwendolen. [Severely.] Really? Your mother, no doubt, or some female
  • Cecily. Oh no! I have no mother, nor, in fact, any relations.
  • Gwendolen. Indeed?
  • Cecily. My dear guardian, with the assistance of Miss Prism, has the
  • Gwendolen. Your guardian?
  • Cecily. Yes, I am Mr. Worthing's ward.
  • Gwendolen. Oh! It is strange he never mentioned to me that he had a
  • ward. How secretive of him! He grows more interesting hourly. I am not
  • delight. [Rising and going to her.] I am very fond of you, Cecily; I
  • Cecily. Pray do! I think that whenever one has anything unpleasant to
  • Gwendolen. Well, to speak with perfect candour, Cecily, I wish that you
  • Cecily. I beg your pardon, Gwendolen, did you say Ernest?
  • Gwendolen. Yes.
  • Cecily. Oh, but it is not Mr. Ernest Worthing who is my guardian. It is
  • Gwendolen. [Sitting down again.] Ernest never mentioned to me that he
  • Cecily. I am sorry to say they have not been on good terms for a long
  • time.
  • Gwendolen. Ah! that accounts for it. And now that I think of it I have
  • Cecily. Quite sure. [A pause.] In fact, I am going to be his.
  • Gwendolen. [Inquiringly.] I beg your pardon?
  • Cecily. [Rather shy and confidingly.] Dearest Gwendolen, there is no
  • Gwendolen. [Quite politely, rising.] My darling Cecily, I think there
  • Cecily. [Very politely, rising.] I am afraid you must be under some
  • misconception. Ernest proposed to me exactly ten minutes ago. [Shows
  • diary.]
  • Gwendolen. [Examines diary through her lorgnettte carefully.] It is
  • Cecily. It would distress me more than I can tell you, dear Gwendolen,
  • mind.
  • Gwendolen. [Meditatively.] If the poor fellow has been entrapped into
  • Cecily. [Thoughtfully and sadly.] Whatever unfortunate entanglement my
  • Gwendolen. Do you allude to me, Miss Cardew, as an entanglement? You
  • Cecily. Do you suggest, Miss Fairfax, that I entrapped Ernest into an
  • Gwendolen. [Satirically.] I am glad to say that I have never seen a
  • spade. It is obvious that our social spheres have been widely different.
  • chafe.]
  • Merriman. Shall I lay tea here as usual, Miss?
  • Cecily. [Sternly, in a calm voice.] Yes, as usual. [Merriman begins to
  • Gwendolen. Are there many interesting walks in the vicinity, Miss
  • Cecily. Oh! yes! a great many. From the top of one of the hills quite
  • Gwendolen. Five counties! I don't think I should like that; I hate
  • crowds.
  • Cecily. [Sweetly.] I suppose that is why you live in town? [Gwendolen
  • Gwendolen. [Looking round.] Quite a well-kept garden this is, Miss
  • Cardew.
  • Cecily. So glad you like it, Miss Fairfax.
  • Gwendolen. I had no idea there were any flowers in the country.
  • Cecily. Oh, flowers are as common here, Miss Fairfax, as people are in
  • London.
  • Gwendolen. Personally I cannot understand how anybody manages to exist
  • Cecily. Ah! This is what the newspapers call agricultural depression,
  • told. May I offer you some tea, Miss Fairfax?
  • Gwendolen. [With elaborate politeness.] Thank you. [Aside.] Detestable
  • Cecily. [Sweetly.] Sugar?
  • Gwendolen. [Superciliously.] No, thank you. Sugar is not fashionable
  • Cecily. [Severely.] Cake or bread and butter?
  • Gwendolen. [In a bored manner.] Bread and butter, please. Cake is
  • Cecily. [Cuts a very large slice of cake, and puts it on the tray.] Hand
  • indignation.]
  • Gwendolen. You have filled my tea with lumps of sugar, and though I
  • Cecily. [Rising.] To save my poor, innocent, trusting boy from the
  • go.
  • Gwendolen. From the moment I saw you I distrusted you. I felt that you
  • Cecily. It seems to me, Miss Fairfax, that I am trespassing on your
  • Gwendolen. [Catching sight of him.] Ernest! My own Ernest!
  • Jack. Gwendolen! Darling! [Offers to kiss her.]
  • Gwendolen. [Draws back.] A moment! May I ask if you are engaged to be
  • Jack. [Laughing.] To dear little Cecily! Of course not! What could
  • Gwendolen. Thank you. You may! [Offers her cheek.]
  • Cecily. [Very sweetly.] I knew there must be some misunderstanding,
  • Gwendolen. I beg your pardon?
  • Cecily. This is Uncle Jack.
  • Gwendolen. [Receding.] Jack! Oh!
  • Cecily. Here is Ernest.
  • Algernon. [Goes straight over to Cecily without noticing any one else.]
  • Cecily. [Drawing back.] A moment, Ernest! May I ask you--are you
  • Algernon. [Looking round.] To what young lady? Good heavens!
  • Cecily. Yes! to good heavens, Gwendolen, I mean to Gwendolen.
  • Algernon. [Laughing.] Of course not! What could have put such an idea
  • Cecily. Thank you. [Presenting her cheek to be kissed.] You may.
  • Gwendolen. I felt there was some slight error, Miss Cardew. The
  • Cecily. [Breaking away from Algernon.] Algernon Moncrieff! Oh! [The
  • Cecily. Are you called Algernon?
  • Algernon. I cannot deny it.
  • Cecily. Oh!
  • Gwendolen. Is your name really John?
  • Jack. [Standing rather proudly.] I could deny it if I liked. I could
  • Cecily. [To Gwendolen.] A gross deception has been practised on both of
  • us.
  • Gwendolen. My poor wounded Cecily!
  • Cecily. My sweet wronged Gwendolen!
  • Gwendolen. [Slowly and seriously.] You will call me sister, will you
  • Cecily. [Rather brightly.] There is just one question I would like to
  • Gwendolen. An admirable idea! Mr. Worthing, there is just one question
  • Jack. [Slowly and hesitatingly.] Gwendolen--Cecily--it is very painful
  • all. I never had a brother in my life, and I certainly have not the
  • Cecily. [Surprised.] No brother at all?
  • Jack. [Cheerily.] None!
  • Gwendolen. [Severely.] Had you never a brother of any kind?
  • Jack. [Pleasantly.] Never. Not even of any kind.
  • Gwendolen. I am afraid it is quite clear, Cecily, that neither of us is
  • Cecily. It is not a very pleasant position for a young girl suddenly to
  • Gwendolen. Let us go into the house. They will hardly venture to come
  • Cecily. No, men are so cowardly, aren't they?
  • Jack. This ghastly state of things is what you call Bunburying, I
  • Algernon. Yes, and a perfectly wonderful Bunbury it is. The most
  • Jack. Well, you've no right whatsoever to Bunbury here.
  • Algernon. That is absurd. One has a right to Bunbury anywhere one
  • chooses. Every serious Bunburyist knows that.
  • Jack. Serious Bunburyist! Good heavens!
  • Algernon. Well, one must be serious about something, if one wants to
  • nature.
  • Jack. Well, the only small satisfaction I have in the whole of this
  • Algernon. Your brother is a little off colour, isn't he, dear Jack? You
  • Jack. As for your conduct towards Miss Cardew, I must say that your
  • Algernon. I can see no possible defence at all for your deceiving a
  • Jack. I wanted to be engaged to Gwendolen, that is all. I love her.
  • Algernon. Well, I simply wanted to be engaged to Cecily. I adore her.
  • Jack. There is certainly no chance of your marrying Miss Cardew.
  • Algernon. I don't think there is much likelihood, Jack, of you and Miss
  • Jack. Well, that is no business of yours.
  • Algernon. If it was my business, I wouldn't talk about it. [Begins to
  • Jack. How can you sit there, calmly eating muffins when we are in this
  • heartless.
  • Algernon. Well, I can't eat muffins in an agitated manner. The butter
  • calmly. It is the only way to eat them.
  • Jack. I say it's perfectly heartless your eating muffins at all, under
  • Algernon. When I am in trouble, eating is the only thing that consoles
  • me. Indeed, when I am in really great trouble, as any one who knows me
  • Jack. [Rising.] Well, that is no reason why you should eat them all in
  • Algernon. [Offering tea-cake.] I wish you would have tea-cake instead.
  • Jack. Good heavens! I suppose a man may eat his own muffins in his own
  • garden.
  • Algernon. But you have just said it was perfectly heartless to eat
  • muffins.
  • Jack. I said it was perfectly heartless of you, under the circumstances.
  • Algernon. That may be. But the muffins are the same. [He seizes the
  • Jack. Algy, I wish to goodness you would go.
  • Algernon. You can't possibly ask me to go without having some dinner.
  • Ernest.
  • Jack. My dear fellow, the sooner you give up that nonsense the better. I
  • Algernon. Yes, but I have not been christened for years.
  • Jack. Yes, but you have been christened. That is the important thing.
  • Algernon. Quite so. So I know my constitution can stand it. If you are
  • unwell. You can hardly have forgotten that some one very closely
  • Jack. Yes, but you said yourself that a severe chill was not hereditary.
  • Algernon. It usen't to be, I know--but I daresay it is now. Science is
  • Jack. [Picking up the muffin-dish.] Oh, that is nonsense; you are
  • Algernon. Jack, you are at the muffins again! I wish you wouldn't.
  • Jack. But I hate tea-cake.
  • Algernon. Why on earth then do you allow tea-cake to be served up for
  • Jack. Algernon! I have already told you to go. I don't want you here.
  • Algernon. I haven't quite finished my tea yet! and there is still one
  • Gwendolen. The fact that they did not follow us at once into the house,
  • Cecily. They have been eating muffins. That looks like repentance.
  • Gwendolen. [After a pause.] They don't seem to notice us at all.
  • Cecily. But I haven't got a cough.
  • Gwendolen. They're looking at us. What effrontery!
  • Cecily. They're approaching. That's very forward of them.
  • Gwendolen. Let us preserve a dignified silence.
  • Cecily. Certainly. It's the only thing to do now. [Enter Jack followed
  • Opera.]
  • Gwendolen. This dignified silence seems to produce an unpleasant effect.
  • Cecily. A most distasteful one.
  • Gwendolen. But we will not be the first to speak.
  • Cecily. Certainly not.
  • Gwendolen. Mr. Worthing, I have something very particular to ask you.
  • Cecily. Gwendolen, your common sense is invaluable. Mr. Moncrieff,
  • Algernon. In order that I might have an opportunity of meeting you.
  • Cecily. [To Gwendolen.] That certainly seems a satisfactory
  • Gwendolen. Yes, dear, if you can believe him.
  • Cecily. I don't. But that does not affect the wonderful beauty of his
  • answer.
  • Gwendolen. True. In matters of grave importance, style, not sincerity
  • Jack. Can you doubt it, Miss Fairfax?
  • Gwendolen. I have the gravest doubts upon the subject. But I intend to
  • Cecily.] Their explanations appear to be quite satisfactory, especially
  • Mr. Worthing's. That seems to me to have the stamp of truth upon it.
  • Cecily. I am more than content with what Mr. Moncrieff said. His voice
  • Gwendolen. Then you think we should forgive them?
  • Cecily. Yes. I mean no.
  • Gwendolen. True! I had forgotten. There are principles at stake that
  • Cecily. Could we not both speak at the same time?
  • Gwendolen. An excellent idea! I nearly always speak at the same time as
  • Cecily. Certainly. [Gwendolen beats time with uplifted finger.]
  • Gwendolen. [To Jack.] For my sake you are prepared to do this terrible
  • Jack. I am.
  • Cecily. [To Algernon.] To please me you are ready to face this fearful
  • Algernon. I am!
  • Gwendolen. How absurd to talk of the equality of the sexes! Where
  • Jack. We are. [Clasps hands with Algernon.]
  • Cecily. They have moments of physical courage of which we women know
  • Gwendolen. [To Jack.] Darling!
  • Algernon. [To Cecily.] Darling! [They fall into each other's arms.]
  • Merriman. Ahem! Ahem! Lady Bracknell!
  • Jack. Good heavens!
  • Gwendolen. Merely that I am engaged to be married to Mr. Worthing,
  • mamma.
  • Jack. I am engaged to be married to Gwendolen, Lady Bracknell!
  • Algernon. Yes, Aunt Augusta.
  • Algernon. [Stammering.] Oh! No! Bunbury doesn't live here. Bunbury
  • Algernon. [Airily.] Oh! I killed Bunbury this afternoon. I mean poor
  • Algernon. Bunbury? Oh, he was quite exploded.
  • Algernon. My dear Aunt Augusta, I mean he was found out! The doctors
  • died.
  • Jack. That lady is Miss Cecily Cardew, my ward. [Lady Bracknell bows
  • Algernon. I am engaged to be married to Cecily, Aunt Augusta.
  • Cecily. Mr. Moncrieff and I are engaged to be married, Lady Bracknell.
  • Jack. [In a clear, cold voice.] Miss Cardew is the grand-daughter of
  • Jack. I have carefully preserved the Court Guides of the period. They
  • publication.
  • Jack. Miss Cardew's family solicitors are Messrs. Markby, Markby, and
  • Markby.
  • satisfied.
  • Jack. [Very irritably.] How extremely kind of you, Lady Bracknell! I
  • Jack. Oh! about a hundred and thirty thousand pounds in the Funds. That
  • surfaces. [To Cecily.] Come over here, dear. [Cecily goes across.]
  • Jack. And after six months nobody knew her.
  • dear. Style largely depends on the way the chin is worn. They are worn
  • Algernon. Yes, Aunt Augusta!
  • profile.
  • Algernon. Cecily is the sweetest, dearest, prettiest girl in the whole
  • world. And I don't care twopence about social possibilities.
  • consent.
  • Algernon. Thank you, Aunt Augusta.
  • Cecily. [Kisses her.] Thank you, Lady Bracknell.
  • Cecily. Thank you, Aunt Augusta.
  • Algernon. Thank you, Aunt Augusta.
  • Cecily. Thank you, Aunt Augusta.
  • engagements. They give people the opportunity of finding out each
  • Jack. I beg your pardon for interrupting you, Lady Bracknell, but this
  • Jack. It pains me very much to have to speak frankly to you, Lady
  • Oxonian.
  • Jack. I fear there can be no possible doubt about the matter. This
  • Jack. That is very generous of you, Lady Bracknell. My own decision,
  • over.] How old are you, dear?
  • Cecily. Well, I am really only eighteen, but I always admit to twenty
  • alteration. Indeed, no woman should ever be quite accurate about her
  • age. It looks so calculating . . . [In a meditative manner.] Eighteen,
  • importance.
  • Jack. Pray excuse me, Lady Bracknell, for interrupting you again, but it
  • Cecily. Algy, could you wait for me till I was thirty-five?
  • Algernon. Of course I could, Cecily. You know I could.
  • Cecily. Yes, I felt it instinctively, but I couldn't wait all that time.
  • cross. I am not punctual myself, I know, but I do like punctuality in
  • Algernon. Then what is to be done, Cecily?
  • Cecily. I don't know, Mr. Moncrieff.
  • Jack. But my dear Lady Bracknell, the matter is entirely in your own
  • hands. The moment you consent to my marriage with Gwendolen, I will most
  • Jack. Then a passionate celibacy is all that any of us can look forward
  • to.
  • trains. To miss any more might expose us to comment on the platform.
  • Chasuble. Everything is quite ready for the christenings.
  • Chasuble. [Looking rather puzzled, and pointing to Jack and Algernon.]
  • Chasuble. Am I to understand then that there are to be no christenings
  • Jack. I don't think that, as things are now, it would be of much
  • Chasuble. I am grieved to hear such sentiments from you, Mr. Worthing.
  • vestry.
  • Chasuble. Yes, Lady Bracknell. I am on my way to join her.
  • Chasuble. [Somewhat indignantly.] She is the most cultivated of ladies,
  • Chasuble. [Severely.] I am a celibate, madam.
  • Jack. [Interposing.] Miss Prism, Lady Bracknell, has been for the last
  • Chasuble. [Looking off.] She approaches; she is nigh.
  • escape.]
  • scandal.] Twenty-eight years ago, Prism, you left Lord Bracknell's
  • Jack. [Who has been listening attentively.] But where did you deposit
  • Jack. Miss Prism, this is a matter of no small importance to me. I
  • infant.
  • Jack. What railway station?
  • Jack. I must retire to my room for a moment. Gwendolen, wait here for
  • me.
  • Gwendolen. If you are not too long, I will wait here for you all my
  • life. [Exit Jack in great excitement.]
  • Chasuble. What do you think this means, Lady Bracknell?
  • Cecily. Uncle Jack seems strangely agitated.
  • Chasuble. Your guardian has a very emotional nature.
  • Chasuble. [Looking up.] It has stopped now. [The noise is redoubled.]
  • Gwendolen. This suspense is terrible. I hope it will last. [Enter Jack
  • Jack. [Rushing over to Miss Prism.] Is this the hand-bag, Miss Prism?
  • mine. I am delighted to have it so unexpectedly restored to me. It has
  • Jack. [In a pathetic voice.] Miss Prism, more is restored to you than
  • Jack. [Embracing her.] Yes . . . mother!
  • Jack. Unmarried! I do not deny that is a serious blow. But after all,
  • Jack. [After a pause.] Lady Bracknell, I hate to seem inquisitive, but
  • Jack. Algy's elder brother! Then I have a brother after all. I knew I
  • Algernon. Well, not till to-day, old boy, I admit. I did my best,
  • Gwendolen. [To Jack.] My own! But what own are you? What is your
  • Jack. Good heavens! . . . I had quite forgotten that point. Your
  • Gwendolen. I never change, except in my affections.
  • Cecily. What a noble nature you have, Gwendolen!
  • Jack. Then the question had better be cleared up at once. Aunt Augusta,
  • Jack. Then I was christened! That is settled. Now, what name was I
  • Jack. [Irritably.] Yes, but what was my father's Christian name?
  • Jack. Algy! Can't you recollect what our father's Christian name was?
  • Algernon. My dear boy, we were never even on speaking terms. He died
  • Jack. His name would appear in the Army Lists of the period, I suppose,
  • Jack. The Army Lists of the last forty years are here. These delightful
  • calmly.] I always told you, Gwendolen, my name was Ernest, didn't I?
  • Gwendolen. Ernest! My own Ernest! I felt from the first that you could
  • Jack. Gwendolen, it is a terrible thing for a man to find out suddenly
  • Gwendolen. I can. For I feel that you are sure to change.
  • Jack. My own one!
  • Chasuble. [To Miss Prism.] Laetitia! [Embraces her]
  • Algernon. Cecily! [Embraces her.] At last!
  • Jack. Gwendolen! [Embraces her.] At last!
  • triviality.
  • Jack. On the contrary, Aunt Augusta, I've now realised for the first
  • FIRST ACT
  • SCENE
  • Morning-room in Algernon's flat in Half-Moon Street. The room is
  • luxuriously and artistically furnished. The sound of a piano is heard in
  • the adjoining room.
  • [Lane is arranging afternoon tea on the table, and after the music has
  • ceased, Algernon enters.]
  • accurately--any one can play accurately--but I play with wonderful
  • keep science for Life.
  • cucumber sandwiches cut for Lady Bracknell?
  • by the way, Lane, I see from your book that on Thursday night, when
  • Lord Shoreman and Mr. Worthing were dining with me, eight bottles of
  • champagne are entered as having been consumed.
  • invariably drink the champagne? I ask merely for information.
  • often observed that in married households the champagne is rarely of a
  • first-rate brand.
  • little experience of it myself up to the present. I have only been
  • married once. That was in consequence of a misunderstanding between
  • myself and a young person.
  • family life, Lane.
  • it myself.
  • lower orders don't set us a good example, what on earth is the use of
  • them? They seem, as a class, to have absolutely no sense of moral
  • [Enter Lane.]
  • [Enter Jack.]
  • [Lane goes out_._]
  • Eating as usual, I see, Algy!
  • take some slight refreshment at five o'clock. Where have you been since
  • last Thursday?
  • excessively boring.
  • cucumber sandwiches? Why such reckless extravagance in one so young? Who
  • is coming to tea?
  • quite approve of your being here.
  • propose to her.
  • romantic to be in love. But there is nothing romantic about a definite
  • the excitement is all over. The very essence of romance is uncertainty.
  • If ever I get married, I'll certainly try to forget the fact.
  • specially invented for people whose memories are so curiously
  • made in Heaven--[Jack puts out his hand to take a sandwich. Algernon at
  • once interferes.] Please don't touch the cucumber sandwiches. They are
  • ordered specially for Aunt Augusta. [Takes one and eats it.]
  • plate from below.] Have some bread and butter. The bread and butter is
  • for Gwendolen. Gwendolen is devoted to bread and butter.
  • butter it is too.
  • eat it all. You behave as if you were married to her already. You are
  • not married to her already, and I don't think you ever will be.
  • extraordinary number of bachelors that one sees all over the place. In
  • the second place, I don't give my consent.
  • allow you to marry her, you will have to clear up the whole question of
  • Cecily! I don't know any one of the name of Cecily.
  • [Enter Lane.]
  • room the last time he dined here.
  • wish to goodness you had let me know. I have been writing frantic
  • letters to Scotland Yard about it. I was very nearly offering a large
  • usually hard up.
  • [Enter Lane with the cigarette case on a salver. Algernon takes it at
  • case and examines it.] However, it makes no matter, for, now that I look
  • at the inscription inside, I find that the thing isn't yours after all.
  • hundred times, and you have no right whatsoever to read what is written
  • should read and what one shouldn't. More than half of modern culture
  • depends on what one shouldn't read.
  • modern culture. It isn't the sort of thing one should talk of in
  • is a present from some one of the name of Cecily, and you said you didn't
  • know any one of that name.
  • Just give it back to me, Algy.
  • little Cecily if she is your aunt and lives at Tunbridge Wells?
  • [Reading.] 'From little Cecily with her fondest love.'
  • earth is there in that? Some aunts are tall, some aunts are not tall.
  • That is a matter that surely an aunt may be allowed to decide for
  • aunt! That is absurd! For Heaven's sake give me back my cigarette case.
  • [Follows Algernon round the room.]
  • Cecily, with her fondest love to her dear Uncle Jack.' There is no
  • objection, I admit, to an aunt being a small aunt, but why an aunt, no
  • matter what her size may be, should call her own nephew her uncle, I
  • can't quite make out. Besides, your name isn't Jack at all; it is
  • to every one as Ernest. You answer to the name of Ernest. You look as
  • if your name was Ernest. You are the most earnest-looking person I ever
  • saw in my life. It is perfectly absurd your saying that your name isn't
  • proof that your name is Ernest if ever you attempt to deny it to me, or
  • to Gwendolen, or to any one else. [Puts the card in his pocket.]
  • cigarette case was given to me in the country.
  • Aunt Cecily, who lives at Tunbridge Wells, calls you her dear uncle.
  • Come, old boy, you had much better have the thing out at once.
  • very vulgar to talk like a dentist when one isn't a dentist. It produces
  • a false impression.
  • Tell me the whole thing. I may mention that I have always suspected you
  • of being a confirmed and secret Bunburyist; and I am quite sure of it
  • as soon as you are kind enough to inform me why you are Ernest in town
  • and Jack in the country.
  • explanation, and pray make it improbable. [Sits on sofa.]
  • at all. In fact it's perfectly ordinary. Old Mr. Thomas Cardew, who
  • adopted me when I was a little boy, made me in his will guardian to his
  • grand-daughter, Miss Cecily Cardew. Cecily, who addresses me as her
  • uncle from motives of respect that you could not possibly appreciate,
  • lives at my place in the country under the charge of her admirable
  • governess, Miss Prism.
  • . . . I may tell you candidly that the place is not in Shropshire.
  • Shropshire on two separate occasions. Now, go on. Why are you Ernest in
  • town and Jack in the country?
  • my real motives. You are hardly serious enough. When one is placed in
  • the position of guardian, one has to adopt a very high moral tone on all
  • be said to conduce very much to either one's health or one's happiness,
  • in order to get up to town I have always pretended to have a younger
  • brother of the name of Ernest, who lives in the Albany, and gets into the
  • most dreadful scrapes. That, my dear Algy, is the whole truth pure and
  • be very tedious if it were either, and modern literature a complete
  • impossibility!
  • try it. You should leave that to people who haven't been at a
  • is a Bunburyist. I was quite right in saying you were a Bunburyist. You
  • are one of the most advanced Bunburyists I know.
  • in order that you may be able to come up to town as often as you like. I
  • have invented an invaluable permanent invalid called Bunbury, in order
  • that I may be able to go down into the country whenever I choose. Bunbury
  • is perfectly invaluable. If it wasn't for Bunbury's extraordinary bad
  • health, for instance, I wouldn't be able to dine with you at Willis's to-
  • night, for I have been really engaged to Aunt Augusta for more than a
  • as not receiving invitations.
  • enough to dine with one's own relations. In the second place, whenever I
  • do dine there I am always treated as a member of the family, and sent
  • down with either no woman at all, or two. In the third place, I know
  • perfectly well whom she will place me next to, to-night. She will place
  • me next Mary Farquhar, who always flirts with her own husband across the
  • dinner-table. That is not very pleasant. Indeed, it is not even decent
  • . . . and that sort of thing is enormously on the increase. The amount
  • of women in London who flirt with their own husbands is perfectly
  • naturally want to talk to you about Bunburying. I want to tell you the
  • to kill my brother, indeed I think I'll kill him in any case. Cecily is
  • a little too much interested in him. It is rather a bore. So I am going
  • to get rid of Ernest. And I strongly advise you to do the same with Mr.
  • . . . with your invalid friend who has the absurd name.
  • get married, which seems to me extremely problematic, you will be very
  • glad to know Bunbury. A man who marries without knowing Bunbury has a
  • very tedious time of it.
  • she is the only girl I ever saw in my life that I would marry, I
  • certainly won't want to know Bunbury.
  • married life three is company and two is none.
  • the corrupt French Drama has been propounding for the last fifty years.
  • to be cynical.
  • such a lot of beastly competition about. [The sound of an electric bell
  • is heard.] Ah! that must be Aunt Augusta. Only relatives, or creditors,
  • ever ring in that Wagnerian manner. Now, if I get her out of the way for
  • ten minutes, so that you can have an opportunity for proposing to
  • Gwendolen, may I dine with you to-night at Willis's?
  • not serious about meals. It is so shallow of them.
  • [Enter Lane.]
  • [Algernon goes forward to meet them. Enter Lady Bracknell and
  • Lady Bracknell. Good afternoon, dear Algernon, I hope you are behaving
  • very well.
  • Lady Bracknell. That's not quite the same thing. In fact the two things
  • rarely go together. [Sees Jack and bows to him with icy coldness.]
  • developments, and I intend to develop in many directions. [Gwendolen and
  • Jack sit down together in the corner.]
  • Lady Bracknell. I'm sorry if we are a little late, Algernon, but I was
  • obliged to call on dear Lady Harbury. I hadn't been there since her poor
  • husband's death. I never saw a woman so altered; she looks quite twenty
  • years younger. And now I'll have a cup of tea, and one of those nice
  • cucumber sandwiches you promised me.
  • Lady Bracknell. Won't you come and sit here, Gwendolen?
  • are there no cucumber sandwiches? I ordered them specially.
  • cucumbers, not even for ready money.
  • Lady Bracknell. It really makes no matter, Algernon. I had some
  • crumpets with Lady Harbury, who seems to me to be living entirely for
  • pleasure now.
  • Lady Bracknell. It certainly has changed its colour. From what cause I,
  • of course, cannot say. [Algernon crosses and hands tea.] Thank you.
  • I've quite a treat for you to-night, Algernon. I am going to send you
  • down with Mary Farquhar. She is such a nice woman, and so attentive to
  • her husband. It's delightful to watch them.
  • pleasure of dining with you to-night after all.
  • Lady Bracknell. [Frowning.] I hope not, Algernon. It would put my
  • table completely out. Your uncle would have to dine upstairs.
  • Fortunately he is accustomed to that.
  • disappointment to me, but the fact is I have just had a telegram to say
  • that my poor friend Bunbury is very ill again. [Exchanges glances with
  • Lady Bracknell. It is very strange. This Mr. Bunbury seems to suffer
  • from curiously bad health.
  • Lady Bracknell. Well, I must say, Algernon, that I think it is high time
  • that Mr. Bunbury made up his mind whether he was going to live or to die.
  • This shilly-shallying with the question is absurd. Nor do I in any way
  • approve of the modern sympathy with invalids. I consider it morbid.
  • Illness of any kind is hardly a thing to be encouraged in others. Health
  • is the primary duty of life. I am always telling that to your poor
  • uncle, but he never seems to take much notice . . . as far as any
  • improvement in his ailment goes. I should be much obliged if you would
  • ask Mr. Bunbury, from me, to be kind enough not to have a relapse on
  • Saturday, for I rely on you to arrange my music for me. It is my last
  • reception, and one wants something that will encourage conversation,
  • particularly at the end of the season when every one has practically said
  • whatever they had to say, which, in most cases, was probably not much.
  • and I think I can promise you he'll be all right by Saturday. Of course
  • the music is a great difficulty. You see, if one plays good music,
  • people don't listen, and if one plays bad music people don't talk. But
  • I'll run over the programme I've drawn out, if you will kindly come into
  • the next room for a moment.
  • Lady Bracknell. Thank you, Algernon. It is very thoughtful of you.
  • [Rising, and following Algernon.] I'm sure the programme will be
  • delightful, after a few expurgations. French songs I cannot possibly
  • look shocked, which is vulgar, or laugh, which is worse. But German
  • sounds a thoroughly respectable language, and indeed, I believe is so.
  • Gwendolen, you will accompany me.
  • [Lady Bracknell and Algernon go into the music-room, Gwendolen remains
  • Whenever people talk to me about the weather, I always feel quite certain
  • that they mean something else. And that makes me so nervous.
  • Bracknell's temporary absence . . .
  • coming back suddenly into a room that I have often had to speak to her
  • you more than any girl . . . I have ever met since . . . I met you.
  • that in public, at any rate, you had been more demonstrative. For me you
  • have always had an irresistible fascination. Even before I met you I was
  • far from indifferent to you. [Jack looks at her in amazement.] We live,
  • as I hope you know, Mr. Worthing, in an age of ideals. The fact is
  • constantly mentioned in the more expensive monthly magazines, and has
  • reached the provincial pulpits, I am told; and my ideal has always been
  • to love some one of the name of Ernest. There is something in that name
  • that inspires absolute confidence. The moment Algernon first mentioned
  • to me that he had a friend called Ernest, I knew I was destined to love
  • name wasn't Ernest?
  • mean to say you couldn't love me then?
  • and like most metaphysical speculations has very little reference at all
  • to the actual facts of real life, as we know them.
  • about the name of Ernest . . . I don't think the name suits me at all.
  • of its own. It produces vibrations.
  • other much nicer names. I think Jack, for instance, a charming name.
  • if any at all, indeed. It does not thrill. It produces absolutely no
  • vibrations . . . I have known several Jacks, and they all, without
  • exception, were more than usually plain. Besides, Jack is a notorious
  • domesticity for John! And I pity any woman who is married to a man
  • called John. She would probably never be allowed to know the entrancing
  • pleasure of a single moment's solitude. The only really safe name is
  • married at once. There is no time to be lost.
  • you led me to believe, Miss Fairfax, that you were not absolutely
  • indifferent to me.
  • has been said at all about marriage. The subject has not even been
  • touched on.
  • you any possible disappointment, Mr. Worthing, I think it only fair to
  • tell you quite frankly before-hand that I am fully determined to accept
  • I am afraid you have had very little experience in how to propose.
  • Gerald does. All my girl-friends tell me so. What wonderfully blue eyes
  • you have, Ernest! They are quite, quite, blue. I hope you will always
  • look at me just like that, especially when there are other people
  • Lady Bracknell. Mr. Worthing! Rise, sir, from this semi-recumbent
  • you to retire. This is no place for you. Besides, Mr. Worthing has not
  • quite finished yet.
  • Lady Bracknell. Finished what, may I ask?
  • Lady Bracknell. Pardon me, you are not engaged to any one. When you do
  • become engaged to some one, I, or your father, should his health permit
  • him, will inform you of the fact. An engagement should come on a young
  • girl as a surprise, pleasant or unpleasant, as the case may be. It is
  • hardly a matter that she could be allowed to arrange for herself . . .
  • And now I have a few questions to put to you, Mr. Worthing. While I am
  • making these inquiries, you, Gwendolen, will wait for me below in the
  • Lady Bracknell. In the carriage, Gwendolen! [Gwendolen goes to the
  • what the noise was. Finally turns round.] Gwendolen, the carriage!
  • Lady Bracknell. [Sitting down.] You can take a seat, Mr. Worthing.
  • [Looks in her pocket for note-book and pencil.]
  • Lady Bracknell. [Pencil and note-book in hand.] I feel bound to tell
  • you that you are not down on my list of eligible young men, although I
  • have the same list as the dear Duchess of Bolton has. We work together,
  • in fact. However, I am quite ready to enter your name, should your
  • answers be what a really affectionate mother requires. Do you smoke?
  • Lady Bracknell. I am glad to hear it. A man should always have an
  • occupation of some kind. There are far too many idle men in London as it
  • Lady Bracknell. A very good age to be married at. I have always been of
  • opinion that a man who desires to get married should know either
  • everything or nothing. Which do you know?
  • Lady Bracknell. I am pleased to hear it. I do not approve of anything
  • that tampers with natural ignorance. Ignorance is like a delicate exotic
  • fruit; touch it and the bloom is gone. The whole theory of modern
  • education is radically unsound. Fortunately in England, at any rate,
  • education produces no effect whatsoever. If it did, it would prove a
  • serious danger to the upper classes, and probably lead to acts of
  • violence in Grosvenor Square. What is your income?
  • Lady Bracknell. [Makes a note in her book.] In land, or in investments?
  • Lady Bracknell. That is satisfactory. What between the duties expected
  • of one during one's lifetime, and the duties exacted from one after one's
  • death, land has ceased to be either a profit or a pleasure. It gives one
  • position, and prevents one from keeping it up. That's all that can be
  • said about land.
  • about fifteen hundred acres, I believe; but I don't depend on that for my
  • real income. In fact, as far as I can make out, the poachers are the
  • only people who make anything out of it.
  • Lady Bracknell. A country house! How many bedrooms? Well, that point
  • can be cleared up afterwards. You have a town house, I hope? A girl
  • with a simple, unspoiled nature, like Gwendolen, could hardly be expected
  • to reside in the country.
  • to Lady Bloxham. Of course, I can get it back whenever I like, at six
  • months' notice.
  • Lady Bracknell. Lady Bloxham? I don't know her.
  • advanced in years.
  • Lady Bracknell. Ah, nowadays that is no guarantee of respectability of
  • Lady Bracknell. [Shaking her head.] The unfashionable side. I thought
  • there was something. However, that could easily be altered.
  • Lady Bracknell. [Sternly.] Both, if necessary, I presume. What are
  • your politics?
  • Lady Bracknell. Oh, they count as Tories. They dine with us. Or come
  • in the evening, at any rate. Now to minor matters. Are your parents
  • living?
  • Lady Bracknell. To lose one parent, Mr. Worthing, may be regarded as a
  • misfortune; to lose both looks like carelessness. Who was your father?
  • He was evidently a man of some wealth. Was he born in what the Radical
  • papers call the purple of commerce, or did he rise from the ranks of the
  • aristocracy?
  • said I had lost my parents. It would be nearer the truth to say that my
  • parents seem to have lost me . . . I don't actually know who I am by
  • Lady Bracknell. Found!
  • and kindly disposition, found me, and gave me the name of Worthing,
  • because he happened to have a first-class ticket for Worthing in his
  • pocket at the time. Worthing is a place in Sussex. It is a seaside
  • Lady Bracknell. Where did the charitable gentleman who had a first-class
  • ticket for this seaside resort find you?
  • Lady Bracknell. A hand-bag?
  • somewhat large, black leather hand-bag, with handles to it--an ordinary
  • hand-bag in fact.
  • Lady Bracknell. In what locality did this Mr. James, or Thomas, Cardew
  • come across this ordinary hand-bag?
  • mistake for his own.
  • Lady Bracknell. The cloak-room at Victoria Station?
  • Lady Bracknell. The line is immaterial. Mr. Worthing, I confess I feel
  • somewhat bewildered by what you have just told me. To be born, or at any
  • rate bred, in a hand-bag, whether it had handles or not, seems to me to
  • display a contempt for the ordinary decencies of family life that reminds
  • one of the worst excesses of the French Revolution. And I presume you
  • know what that unfortunate movement led to? As for the particular
  • locality in which the hand-bag was found, a cloak-room at a railway
  • station might serve to conceal a social indiscretion--has probably,
  • indeed, been used for that purpose before now--but it could hardly be
  • regarded as an assured basis for a recognised position in good society.
  • say I would do anything in the world to ensure Gwendolen's happiness.
  • Lady Bracknell. I would strongly advise you, Mr. Worthing, to try and
  • acquire some relations as soon as possible, and to make a definite effort
  • to produce at any rate one parent, of either sex, before the season is
  • quite over.
  • produce the hand-bag at any moment. It is in my dressing-room at home. I
  • really think that should satisfy you, Lady Bracknell.
  • Lady Bracknell. Me, sir! What has it to do with me? You can hardly
  • imagine that I and Lord Bracknell would dream of allowing our only
  • daughter--a girl brought up with the utmost care--to marry into a cloak-
  • room, and form an alliance with a parcel? Good morning, Mr. Worthing!
  • [Lady Bracknell sweeps out in majestic indignation.]
  • Wedding March. Jack looks perfectly furious, and goes to the door.] For
  • goodness' sake don't play that ghastly tune, Algy. How idiotic you are!
  • [The music stops and Algernon enters cheerily.]
  • Gwendolen refused you? I know it is a way she has. She is always
  • refusing people. I think it is most ill-natured of her.
  • concerned, we are engaged. Her mother is perfectly unbearable. Never
  • met such a Gorgon . . . I don't really know what a Gorgon is like, but I
  • am quite sure that Lady Bracknell is one. In any case, she is a monster,
  • without being a myth, which is rather unfair . . . I beg your pardon,
  • Algy, I suppose I shouldn't talk about your own aunt in that way before
  • only thing that makes me put up with them at all. Relations are simply a
  • tedious pack of people, who haven't got the remotest knowledge of how to
  • live, nor the smallest instinct about when to die.
  • about things.
  • You don't think there is any chance of Gwendolen becoming like her mother
  • in about a hundred and fifty years, do you, Algy?
  • No man does. That's his.
  • in civilised life should be.
  • You can't go anywhere without meeting clever people. The thing has
  • become an absolute public nuisance. I wish to goodness we had a few
  • fools left.
  • Ernest in town, and Jack in the country?
  • quite the sort of thing one tells to a nice, sweet, refined girl. What
  • extraordinary ideas you have about the way to behave to a woman!
  • she is pretty, and to some one else, if she is plain.
  • say he died in Paris of apoplexy. Lots of people die of apoplexy, quite
  • suddenly, don't they?
  • thing that runs in families. You had much better say a severe chill.
  • kind?
  • in Paris, by a severe chill. That gets rid of him.
  • much interested in your poor brother Ernest? Won't she feel his loss a
  • good deal?
  • glad to say. She has got a capital appetite, goes long walks, and pays
  • no attention at all to her lessons.
  • pretty, and she is only just eighteen.
  • pretty ward who is only just eighteen?
  • Gwendolen are perfectly certain to be extremely great friends. I'll bet
  • you anything you like that half an hour after they have met, they will be
  • calling each other sister.
  • other things first. Now, my dear boy, if we want to get a good table at
  • Willis's, we really must go and dress. Do you know it is nearly seven?
  • hard work where there is no definite object of any kind.
  • [Enter Lane.]
  • [Enter Gwendolen. Lane goes out.]
  • particular to say to Mr. Worthing.
  • mamma's face I fear we never shall. Few parents nowadays pay any regard
  • to what their children say to them. The old-fashioned respect for the
  • young is fast dying out. Whatever influence I ever had over mamma, I
  • lost at the age of three. But although she may prevent us from becoming
  • man and wife, and I may marry some one else, and marry often, nothing
  • that she can possibly do can alter my eternal devotion to you.
  • with unpleasing comments, has naturally stirred the deeper fibres of my
  • simplicity of your character makes you exquisitely incomprehensible to
  • country?
  • [Algernon, who has been carefully listening, smiles to himself, and
  • writes the address on his shirt-cuff. Then picks up the Railway Guide.]
  • necessary to do something desperate. That of course will require serious
  • [Lane presents several letters on a salver to Algernon. It is to be
  • surmised that they are bills, as Algernon, after looking at the
  • envelopes, tears them up.]
  • dress clothes, my smoking jacket, and all the Bunbury suits . . .
  • [Enter Jack. Lane goes off.]
  • for in my life. [Algernon is laughing immoderately.] What on earth are
  • you so amused at?
  • serious scrape some day.
  • [Jack looks indignantly at him, and leaves the room. Algernon lights a
  • cigarette, reads his shirt-cuff, and smiles.]
  • ACT DROP
  • SECOND ACT
  • SCENE
  • Garden at the Manor House. A flight of grey stone steps leads up to the
  • large yew-tree.
  • [Miss Prism discovered seated at the table. Cecily is at the back
  • watering flowers.]
  • Miss Prism. [Calling.] Cecily, Cecily! Surely such a utilitarian
  • occupation as the watering of flowers is rather Moulton's duty than
  • yours? Especially at a moment when intellectual pleasures await you.
  • Your German grammar is on the table. Pray open it at page fifteen. We
  • will repeat yesterday's lesson.
  • at all a becoming language. I know perfectly well that I look quite
  • plain after my German lesson.
  • Miss Prism. Child, you know how anxious your guardian is that you should
  • improve yourself in every way. He laid particular stress on your German,
  • as he was leaving for town yesterday. Indeed, he always lays stress on
  • your German when he is leaving for town.
  • that I think he cannot be quite well.
  • Miss Prism. [Drawing herself up.] Your guardian enjoys the best of
  • health, and his gravity of demeanour is especially to be commended in one
  • so comparatively young as he is. I know no one who has a higher sense of
  • duty and responsibility.
  • three are together.
  • Miss Prism. Cecily! I am surprised at you. Mr. Worthing has many
  • troubles in his life. Idle merriment and triviality would be out of
  • place in his conversation. You must remember his constant anxiety about
  • that unfortunate young man his brother.
  • brother, to come down here sometimes. We might have a good influence
  • over him, Miss Prism. I am sure you certainly would. You know German,
  • and geology, and things of that kind influence a man very much. [Cecily
  • begins to write in her diary.]
  • Miss Prism. [Shaking her head.] I do not think that even I could
  • produce any effect on a character that according to his own brother's
  • admission is irretrievably weak and vacillating. Indeed I am not sure
  • that I would desire to reclaim him. I am not in favour of this modern
  • mania for turning bad people into good people at a moment's notice. As a
  • man sows so let him reap. You must put away your diary, Cecily. I
  • really don't see why you should keep a diary at all.
  • Miss Prism. Memory, my dear Cecily, is the diary that we all carry about
  • with us.
  • happened, and couldn't possibly have happened. I believe that Memory is
  • responsible for nearly all the three-volume novels that Mudie sends us.
  • Miss Prism. Do not speak slightingly of the three-volume novel, Cecily.
  • I wrote one myself in earlier days.
  • hope it did not end happily? I don't like novels that end happily. They
  • depress me so much.
  • Miss Prism. The good ended happily, and the bad unhappily. That is what
  • Fiction means.
  • ever published?
  • Miss Prism. Alas! no. The manuscript unfortunately was abandoned.
  • [Cecily starts.] I use the word in the sense of lost or mislaid. To
  • your work, child, these speculations are profitless.
  • Miss Prism. [Rising and advancing.] Dr. Chasuble! This is indeed a
  • [Enter Canon Chasuble.]
  • well?
  • think it would do her so much good to have a short stroll with you in the
  • Park, Dr. Chasuble.
  • Miss Prism. Cecily, I have not mentioned anything about a headache.
  • you had a headache. Indeed I was thinking about that, and not about my
  • German lesson, when the Rector came in.
  • pupil, I would hang upon her lips. [Miss Prism glares.] I spoke
  • suppose, has not returned from town yet?
  • Miss Prism. We do not expect him till Monday afternoon.
  • not one of those whose sole aim is enjoyment, as, by all accounts, that
  • unfortunate young man his brother seems to be. But I must not disturb
  • Egeria and her pupil any longer.
  • Miss Prism. Egeria? My name is Laetitia, Doctor.
  • Miss Prism. I think, dear Doctor, I will have a stroll with you. I find
  • I have a headache after all, and a walk might do it good.
  • as the schools and back.
  • Miss Prism. That would be delightful. Cecily, you will read your
  • Political Economy in my absence. The chapter on the Fall of the Rupee
  • you may omit. It is somewhat too sensational. Even these metallic
  • problems have their melodramatic side.
  • [Goes down the garden with Dr. Chasuble.]
  • Political Economy! Horrid Geography! Horrid, horrid German!
  • [Enter Merriman with a card on a salver.]
  • has brought his luggage with him.
  • Albany, W.' Uncle Jack's brother! Did you tell him Mr. Worthing was in
  • town?
  • that you and Miss Prism were in the garden. He said he was anxious to
  • speak to you privately for a moment.
  • talk to the housekeeper about a room for him.
  • [Merriman goes off.]
  • [Enter Algernon, very gay and debonnair.] He does!
  • I believe I am more than usually tall for my age. [Algernon is rather
  • taken aback.] But I am your cousin Cecily. You, I see from your card,
  • are Uncle Jack's brother, my cousin Ernest, my wicked cousin Ernest.
  • think that I am wicked.
  • a very inexcusable manner. I hope you have not been leading a double
  • life, pretending to be wicked and being really good all the time. That
  • would be hypocrisy.
  • rather reckless.
  • my own small way.
  • it must have been very pleasant.
  • back till Monday afternoon.
  • first train on Monday morning. I have a business appointment that I am
  • anxious . . . to miss?
  • business engagement, if one wants to retain any sense of the beauty of
  • life, but still I think you had better wait till Uncle Jack arrives. I
  • know he wants to speak to you about your emigrating.
  • in neckties at all.
  • you to Australia.
  • to choose between this world, the next world, and Australia.
  • next world, are not particularly encouraging. This world is good enough
  • for me, cousin Cecily.
  • You might make that your mission, if you don't mind, cousin Cecily.
  • is going to lead an entirely new life, one requires regular and wholesome
  • appetite unless I have a buttonhole first.
  • Miss Prism never says such things to me.
  • rose in his buttonhole.] You are the prettiest girl I ever saw.
  • caught in.
  • shouldn't know what to talk to him about.
  • [They pass into the house. Miss Prism and Dr. Chasuble return.]
  • Miss Prism. You are too much alone, dear Dr. Chasuble. You should get
  • neologistic a phrase. The precept as well as the practice of the
  • Primitive Church was distinctly against matrimony.
  • Miss Prism. [Sententiously.] That is obviously the reason why the
  • Primitive Church has not lasted up to the present day. And you do not
  • seem to realise, dear Doctor, that by persistently remaining single, a
  • man converts himself into a permanent public temptation. Men should be
  • more careful; this very celibacy leads weaker vessels astray.
  • Miss Prism. No married man is ever attractive except to his wife.
  • Miss Prism. That depends on the intellectual sympathies of the woman.
  • Maturity can always be depended on. Ripeness can be trusted. Young
  • women are green. [Dr. Chasuble starts.] I spoke horticulturally. My
  • metaphor was drawn from fruits. But where is Cecily?
  • [Enter Jack slowly from the back of the garden. He is dressed in the
  • deepest mourning, with crape hatband and black gloves.]
  • Miss Prism. Mr. Worthing!
  • Miss Prism. This is indeed a surprise. We did not look for you till
  • Monday afternoon.
  • sooner than I expected. Dr. Chasuble, I hope you are well?
  • some terrible calamity?
  • Miss Prism. More shameful debts and extravagance?
  • Miss Prism. What a lesson for him! I trust he will profit by it.
  • least the consolation of knowing that you were always the most generous
  • and forgiving of brothers.
  • night from the manager of the Grand Hotel.
  • Miss Prism. As a man sows, so shall he reap.
  • of us are perfect. I myself am peculiarly susceptible to draughts. Will
  • the interment take place here?
  • any very serious state of mind at the last. You would no doubt wish me
  • to make some slight allusion to this tragic domestic affliction next
  • of the manna in the wilderness can be adapted to almost any occasion,
  • joyful, or, as in the present case, distressing. [All sigh.] I have
  • preached it at harvest celebrations, christenings, confirmations, on days
  • of humiliation and festal days. The last time I delivered it was in the
  • Cathedral, as a charity sermon on behalf of the Society for the
  • Prevention of Discontent among the Upper Orders. The Bishop, who was
  • present, was much struck by some of the analogies I drew.
  • Chasuble? I suppose you know how to christen all right? [Dr. Chasuble
  • looks astounded.] I mean, of course, you are continually christening,
  • aren't you?
  • Miss Prism. It is, I regret to say, one of the Rector's most constant
  • duties in this parish. I have often spoken to the poorer classes on the
  • Miss Prism. [Bitterly.] People who live entirely for pleasure usually
  • afternoon, if you have nothing better to do.
  • would bother you in any way, or if you think I am a little too old now.
  • adults is a perfectly canonical practice.
  • necessary, or indeed I think advisable. Our weather is so changeable. At
  • what hour would you wish the ceremony performed?
  • to perform at that time. A case of twins that occurred recently in one
  • of the outlying cottages on your own estate. Poor Jenkins the carter, a
  • most hard-working man.
  • Worthing, I will not intrude any longer into a house of sorrow. I would
  • merely beg you not to be too much bowed down by grief. What seem to us
  • bitter trials are often blessings in disguise.
  • Miss Prism. This seems to me a blessing of an extremely obvious kind.
  • [Enter Cecily from the house.]
  • clothes you have got on! Do go and change them.
  • Miss Prism. Cecily!
  • brow in a melancholy manner.]
  • you had toothache, and I have got such a surprise for you. Who do you
  • think is in the dining-room? Your brother!
  • the past he is still your brother. You couldn't be so heartless as to
  • disown him. I'll tell him to come out. And you will shake hands with
  • him, won't you, Uncle Jack? [Runs back into the house.]
  • Miss Prism. After we had all been resigned to his loss, his sudden
  • return seems to me peculiarly distressing.
  • I think it is perfectly absurd.
  • [Enter Algernon and Cecily hand in hand. They come slowly up to Jack.]
  • very sorry for all the trouble I have given you, and that I intend to
  • lead a better life in the future. [Jack glares at him and does not take
  • his hand.]
  • here disgraceful. He knows perfectly well why.
  • has just been telling me about his poor invalid friend Mr. Bunbury whom
  • he goes to visit so often. And surely there must be much good in one who
  • is kind to an invalid, and leaves the pleasures of London to sit by a bed
  • of pain.
  • state of health.
  • about anything else. It is enough to drive one perfectly frantic.
  • must say that I think that Brother John's coldness to me is peculiarly
  • it is the first time I have come here.
  • forgive you.
  • Algernon and glares.]
  • I think we might leave the two brothers together.
  • Miss Prism. Cecily, you will come with us.
  • Miss Prism. We must not be premature in our judgments.
  • as possible. I don't allow any Bunburying here.
  • [Enter Merriman.]
  • I suppose that is all right?
  • the room next to your own.
  • and a large luncheon-basket.
  • suddenly called back to town.
  • back to town at all.
  • in the smallest degree.
  • ridiculous in them. Why on earth don't you go up and change? It is
  • perfectly childish to be in deep mourning for a man who is actually
  • staying for a whole week with you in your house as a guest. I call it
  • or anything else. You have got to leave . . . by the four-five train.
  • would be most unfriendly. If I were in mourning you would stay with me,
  • I suppose. I should think it very unkind if you didn't.
  • long to dress, and with such little result.
  • as you are.
  • by being always immensely over-educated.
  • presence in my garden utterly absurd. However, you have got to catch the
  • four-five, and I hope you will have a pleasant journey back to town. This
  • Bunburying, as you call it, has not been a great success for you.
  • [Goes into the house.]
  • and that is everything.
  • [Enter Cecily at the back of the garden. She picks up the can and begins
  • to water the flowers.] But I must see her before I go, and make
  • arrangements for another Bunbury. Ah, there she is.
  • with Uncle Jack.
  • a very brief space of time. The absence of old friends one can endure
  • with equanimity. But even a momentary separation from anyone to whom one
  • has just been introduced is almost unbearable.
  • [Enter Merriman.]
  • at Cecily.]
  • frankly and openly that you seem to me to be in every way the visible
  • personification of absolute perfection.
  • will allow me, I will copy your remarks into my diary. [Goes over to
  • table and begins writing in diary.]
  • May I?
  • young girl's record of her own thoughts and impressions, and consequently
  • meant for publication. When it appears in volume form I hope you will
  • order a copy. But pray, Ernest, don't stop. I delight in taking down
  • from dictation. I have reached 'absolute perfection'. You can go on. I
  • am quite ready for more.
  • fluently and not cough. Besides, I don't know how to spell a cough.
  • [Writes as Algernon speaks.]
  • upon your wonderful and incomparable beauty, I have dared to love you
  • wildly, passionately, devotedly, hopelessly.
  • passionately, devotedly, hopelessly. Hopelessly doesn't seem to make
  • much sense, does it?
  • [Enter Merriman.]
  • [Merriman retires.]
  • staying on till next week, at the same hour.
  • whole world but you. I love you, Cecily. You will marry me, won't you?
  • last three months.
  • had a younger brother who was very wicked and bad, you of course have
  • formed the chief topic of conversation between myself and Miss Prism. And
  • of course a man who is much talked about is always very attractive. One
  • feels there must be something in him, after all. I daresay it was
  • foolish of me, but I fell in love with you, Ernest.
  • of my existence, I determined to end the matter one way or the other, and
  • after a long struggle with myself I accepted you under this dear old tree
  • the little bangle with the true lover's knot I promised you always to
  • I've always given for your leading such a bad life. And this is the box
  • in which I keep all your dear letters. [Kneels at table, opens box, and
  • produces letters tied up with blue ribbon.]
  • you any letters.
  • well that I was forced to write your letters for you. I wrote always
  • three times a week, and sometimes oftener.
  • [Replaces box.] The three you wrote me after I had broken off the
  • engagement are so beautiful, and so badly spelled, that even now I can
  • hardly read them without crying a little.
  • entry if you like. [Shows diary.] 'To-day I broke off my engagement with
  • had done nothing at all. Cecily, I am very much hurt indeed to hear you
  • broke it off. Particularly when the weather was so charming.
  • hadn't been broken off at least once. But I forgave you before the week
  • was out.
  • are, Cecily.
  • through his hair.] I hope your hair curls naturally, does it?
  • girlish dream of mine to love some one whose name was Ernest. [Algernon
  • rises, Cecily also.] There is something in that name that seems to
  • inspire absolute confidence. I pity any poor married woman whose husband
  • is not called Ernest.
  • if I had some other name?
  • can't see why you should object to the name of Algernon. It is not at
  • all a bad name. In fact, it is rather an aristocratic name. Half of the
  • chaps who get into the Bankruptcy Court are called Algernon. But
  • seriously, Cecily . . . [Moving to her] . . . if my name was Algy,
  • couldn't you love me?
  • character, but I fear that I should not be able to give you my undivided
  • suppose, thoroughly experienced in the practice of all the rites and
  • ceremonials of the Church?
  • written a single book, so you can imagine how much he knows.
  • on most important business.
  • and that I only met you to-day for the first time, I think it is rather
  • hard that you should leave me for so long a period as half an hour.
  • Couldn't you make it twenty minutes?
  • [Kisses her and rushes down the garden.]
  • enter his proposal in my diary.
  • [Enter Merriman.]
  • important business, Miss Fairfax states.
  • time ago.
  • back soon. And you can bring tea.
  • are associated with Uncle Jack in some of his philanthropic work in
  • [Enter Merriman.]
  • [Enter Gwendolen.]
  • [Exit Merriman.]
  • My name is Cecily Cardew.
  • very sweet name! Something tells me that we are going to be great
  • of people are never wrong.
  • other such a comparatively short time. Pray sit down.
  • mentioning who I am. My father is Lord Bracknell. You have never heard
  • of papa, I suppose?
  • entirely unknown. I think that is quite as it should be. The home seems
  • to me to be the proper sphere for the man. And certainly once a man
  • begins to neglect his domestic duties he becomes painfully effeminate,
  • does he not? And I don't like that. It makes men so very attractive.
  • Cecily, mamma, whose views on education are remarkably strict, has
  • brought me up to be extremely short-sighted; it is part of her system; so
  • do you mind my looking at you through my glasses?
  • are here on a short visit, I suppose.
  • relative of advanced years, resides here also?
  • arduous task of looking after me.
  • sure, however, that the news inspires me with feelings of unmixed
  • have liked you ever since I met you! But I am bound to state that now
  • that I know that you are Mr. Worthing's ward, I cannot help expressing a
  • wish you were--well, just a little older than you seem to be--and not
  • quite so very alluring in appearance. In fact, if I may speak candidly--
  • say, one should always be quite candid.
  • were fully forty-two, and more than usually plain for your age. Ernest
  • has a strong upright nature. He is the very soul of truth and honour.
  • Disloyalty would be as impossible to him as deception. But even men of
  • the noblest possible moral character are extremely susceptible to the
  • influence of the physical charms of others. Modern, no less than Ancient
  • History, supplies us with many most painful examples of what I refer to.
  • If it were not so, indeed, History would be quite unreadable.
  • his brother--his elder brother.
  • had a brother.
  • never heard any man mention his brother. The subject seems distasteful
  • to most men. Cecily, you have lifted a load from my mind. I was growing
  • almost anxious. It would have been terrible if any cloud had come across
  • a friendship like ours, would it not? Of course you are quite, quite
  • sure that it is not Mr. Ernest Worthing who is your guardian?
  • reason why I should make a secret of it to you. Our little county
  • newspaper is sure to chronicle the fact next week. Mr. Ernest Worthing
  • and I are engaged to be married.
  • must be some slight error. Mr. Ernest Worthing is engaged to me. The
  • announcement will appear in the _Morning Post_ on Saturday at the latest.
  • certainly very curious, for he asked me to be his wife yesterday
  • afternoon at 5.30. If you would care to verify the incident, pray do so.
  • [Produces diary of her own.] I never travel without my diary. One
  • should always have something sensational to read in the train. I am so
  • sorry, dear Cecily, if it is any disappointment to you, but I am afraid I
  • have the prior claim.
  • if it caused you any mental or physical anguish, but I feel bound to
  • point out that since Ernest proposed to you he clearly has changed his
  • any foolish promise I shall consider it my duty to rescue him at once,
  • and with a firm hand.
  • dear boy may have got into, I will never reproach him with it after we
  • are married.
  • are presumptuous. On an occasion of this kind it becomes more than a
  • moral duty to speak one's mind. It becomes a pleasure.
  • engagement? How dare you? This is no time for wearing the shallow mask
  • of manners. When I see a spade I call it a spade.
  • [Enter Merriman, followed by the footman. He carries a salver, table
  • cloth, and plate stand. Cecily is about to retort. The presence of the
  • servants exercises a restraining influence, under which both girls
  • clear table and lay cloth. A long pause. Cecily and Gwendolen glare at
  • each other.]
  • Cardew?
  • close one can see five counties.
  • bites her lip, and beats her foot nervously with her parasol.]
  • in the country, if anybody who is anybody does. The country always bores
  • me to death.
  • is it not? I believe the aristocracy are suffering very much from it
  • just at present. It is almost an epidemic amongst them, I have been
  • girl! But I require tea!
  • any more. [Cecily looks angrily at her, takes up the tongs and puts four
  • lumps of sugar into the cup.]
  • rarely seen at the best houses nowadays.
  • that to Miss Fairfax.
  • [Merriman does so, and goes out with footman. Gwendolen drinks the tea
  • and makes a grimace. Puts down cup at once, reaches out her hand to the
  • bread and butter, looks at it, and finds it is cake. Rises in
  • asked most distinctly for bread and butter, you have given me cake. I am
  • known for the gentleness of my disposition, and the extraordinary
  • sweetness of my nature, but I warn you, Miss Cardew, you may go too far.
  • machinations of any other girl there are no lengths to which I would not
  • were false and deceitful. I am never deceived in such matters. My first
  • impressions of people are invariably right.
  • valuable time. No doubt you have many other calls of a similar character
  • to make in the neighbourhood.
  • [Enter Jack.]
  • married to this young lady? [Points to Cecily.]
  • have put such an idea into your pretty little head?
  • Miss Fairfax. The gentleman whose arm is at present round your waist is
  • my guardian, Mr. John Worthing.
  • [Enter Algernon.]
  • My own love! [Offers to kiss her.]
  • engaged to be married to this young lady?
  • Gwendolen!
  • into your pretty little head?
  • [Algernon kisses her.]
  • gentleman who is now embracing you is my cousin, Mr. Algernon Moncrieff.
  • two girls move towards each other and put their arms round each other's
  • waists as if for protection.]
  • deny anything if I liked. But my name certainly is John. It has been
  • John for years.
  • not? [They embrace. Jack and Algernon groan and walk up and down.]
  • be allowed to ask my guardian.
  • I would like to be permitted to put to you. Where is your brother
  • Ernest? We are both engaged to be married to your brother Ernest, so it
  • is a matter of some importance to us to know where your brother Ernest is
  • at present.
  • for me to be forced to speak the truth. It is the first time in my life
  • that I have ever been reduced to such a painful position, and I am really
  • quite inexperienced in doing anything of the kind. However, I will tell
  • you quite frankly that I have no brother Ernest. I have no brother at
  • smallest intention of ever having one in the future.
  • engaged to be married to any one.
  • find herself in. Is it?
  • after us there.
  • [They retire into the house with scornful looks.]
  • suppose?
  • wonderful Bunbury I have ever had in my life.
  • have any amusement in life. I happen to be serious about Bunburying.
  • What on earth you are serious about I haven't got the remotest idea.
  • About everything, I should fancy. You have such an absolutely trivial
  • wretched business is that your friend Bunbury is quite exploded. You
  • won't be able to run down to the country quite so often as you used to
  • do, dear Algy. And a very good thing too.
  • won't be able to disappear to London quite so frequently as your wicked
  • custom was. And not a bad thing either.
  • taking in a sweet, simple, innocent girl like that is quite inexcusable.
  • To say nothing of the fact that she is my ward.
  • brilliant, clever, thoroughly experienced young lady like Miss Fairfax.
  • To say nothing of the fact that she is my cousin.
  • Fairfax being united.
  • eat muffins.] It is very vulgar to talk about one's business. Only
  • people like stock-brokers do that, and then merely at dinner parties.
  • horrible trouble, I can't make out. You seem to me to be perfectly
  • would probably get on my cuffs. One should always eat muffins quite
  • the circumstances.
  • intimately will tell you, I refuse everything except food and drink. At
  • the present moment I am eating muffins because I am unhappy. Besides, I
  • am particularly fond of muffins. [Rising.]
  • that greedy way. [Takes muffins from Algernon.]
  • I don't like tea-cake.
  • That is a very different thing.
  • muffin-dish from Jack.]
  • It's absurd. I never go without my dinner. No one ever does, except
  • vegetarians and people like that. Besides I have just made arrangements
  • with Dr. Chasuble to be christened at a quarter to six under the name of
  • made arrangements this morning with Dr. Chasuble to be christened myself
  • at 5.30, and I naturally will take the name of Ernest. Gwendolen would
  • wish it. We can't both be christened Ernest. It's absurd. Besides, I
  • have a perfect right to be christened if I like. There is no evidence at
  • all that I have ever been christened by anybody. I should think it
  • extremely probable I never was, and so does Dr. Chasuble. It is entirely
  • different in your case. You have been christened already.
  • not quite sure about your ever having been christened, I must say I think
  • it rather dangerous your venturing on it now. It might make you very
  • connected with you was very nearly carried off this week in Paris by a
  • severe chill.
  • always making wonderful improvements in things.
  • always talking nonsense.
  • There are only two left. [Takes them.] I told you I was particularly
  • fond of muffins.
  • your guests? What ideas you have of hospitality!
  • Why don't you go!
  • muffin left. [Jack groans, and sinks into a chair. Algernon still
  • continues eating.]
  • ACT DROP
  • THIRD ACT
  • SCENE
  • Morning-room at the Manor House.
  • [Gwendolen and Cecily are at the window, looking out into the garden.]
  • as any one else would have done, seems to me to show that they have some
  • sense of shame left.
  • Couldn't you cough?
  • by Algernon. They whistle some dreadful popular air from a British
  • Much depends on your reply.
  • kindly answer me the following question. Why did you pretend to be my
  • guardian's brother?
  • explanation, does it not?
  • is the vital thing. Mr. Worthing, what explanation can you offer to me
  • for pretending to have a brother? Was it in order that you might have an
  • opportunity of coming up to town to see me as often as possible?
  • crush them. This is not the moment for German scepticism. [Moving to
  • alone inspires one with absolute credulity.
  • one cannot surrender. Which of us should tell them? The task is not a
  • pleasant one.
  • other people. Will you take the time from me?
  • Gwendolen and Cecily [Speaking together.] Your Christian names are still
  • an insuperable barrier. That is all!
  • Jack and Algernon [Speaking together.] Our Christian names! Is that
  • all? But we are going to be christened this afternoon.
  • thing?
  • ordeal?
  • questions of self-sacrifice are concerned, men are infinitely beyond us.
  • absolutely nothing.
  • [Enter Merriman. When he enters he coughs loudly, seeing the situation.]
  • [Enter Lady Bracknell. The couples separate in alarm. Exit Merriman.]
  • Lady Bracknell. Gwendolen! What does this mean?
  • Lady Bracknell. Come here. Sit down. Sit down immediately. Hesitation
  • of any kind is a sign of mental decay in the young, of physical weakness
  • in the old. [Turns to Jack.] Apprised, sir, of my daughter's sudden
  • flight by her trusty maid, whose confidence I purchased by means of a
  • small coin, I followed her at once by a luggage train. Her unhappy
  • father is, I am glad to say, under the impression that she is attending a
  • more than usually lengthy lecture by the University Extension Scheme on
  • the Influence of a permanent income on Thought. I do not propose to
  • undeceive him. Indeed I have never undeceived him on any question. I
  • would consider it wrong. But of course, you will clearly understand that
  • all communication between yourself and my daughter must cease immediately
  • from this moment. On this point, as indeed on all points, I am firm.
  • Lady Bracknell. You are nothing of the kind, sir. And now, as regards
  • Algernon! . . . Algernon!
  • Lady Bracknell. May I ask if it is in this house that your invalid
  • friend Mr. Bunbury resides?
  • is somewhere else at present. In fact, Bunbury is dead.
  • Lady Bracknell. Dead! When did Mr. Bunbury die? His death must have
  • been extremely sudden.
  • Bunbury died this afternoon.
  • Lady Bracknell. What did he die of?
  • Lady Bracknell. Exploded! Was he the victim of a revolutionary outrage?
  • I was not aware that Mr. Bunbury was interested in social legislation. If
  • so, he is well punished for his morbidity.
  • found out that Bunbury could not live, that is what I mean--so Bunbury
  • Lady Bracknell. He seems to have had great confidence in the opinion of
  • his physicians. I am glad, however, that he made up his mind at the last
  • to some definite course of action, and acted under proper medical advice.
  • And now that we have finally got rid of this Mr. Bunbury, may I ask, Mr.
  • Worthing, who is that young person whose hand my nephew Algernon is now
  • holding in what seems to me a peculiarly unnecessary manner?
  • coldly to Cecily.]
  • Lady Bracknell. I beg your pardon?
  • Lady Bracknell. [With a shiver, crossing to the sofa and sitting down.]
  • I do not know whether there is anything peculiarly exciting in the air of
  • this particular part of Hertfordshire, but the number of engagements that
  • go on seems to me considerably above the proper average that statistics
  • have laid down for our guidance. I think some preliminary inquiry on my
  • part would not be out of place. Mr. Worthing, is Miss Cardew at all
  • connected with any of the larger railway stations in London? I merely
  • desire information. Until yesterday I had no idea that there were any
  • families or persons whose origin was a Terminus. [Jack looks perfectly
  • furious, but restrains himself.]
  • the late Mr. Thomas Cardew of 149 Belgrave Square, S.W.; Gervase Park,
  • Dorking, Surrey; and the Sporran, Fifeshire, N.B.
  • Lady Bracknell. That sounds not unsatisfactory. Three addresses always
  • inspire confidence, even in tradesmen. But what proof have I of their
  • authenticity?
  • are open to your inspection, Lady Bracknell.
  • Lady Bracknell. [Grimly.] I have known strange errors in that
  • Lady Bracknell. Markby, Markby, and Markby? A firm of the very highest
  • position in their profession. Indeed I am told that one of the Mr.
  • Markby's is occasionally to be seen at dinner parties. So far I am
  • have also in my possession, you will be pleased to hear, certificates of
  • Miss Cardew's birth, baptism, whooping cough, registration, vaccination,
  • confirmation, and the measles; both the German and the English variety.
  • Lady Bracknell. Ah! A life crowded with incident, I see; though perhaps
  • somewhat too exciting for a young girl. I am not myself in favour of
  • premature experiences. [Rises, looks at her watch.] Gwendolen! the time
  • approaches for our departure. We have not a moment to lose. As a matter
  • of form, Mr. Worthing, I had better ask you if Miss Cardew has any little
  • fortune?
  • is all. Goodbye, Lady Bracknell. So pleased to have seen you.
  • Lady Bracknell. [Sitting down again.] A moment, Mr. Worthing. A
  • hundred and thirty thousand pounds! And in the Funds! Miss Cardew seems
  • to me a most attractive young lady, now that I look at her. Few girls of
  • the present day have any really solid qualities, any of the qualities
  • that last, and improve with time. We live, I regret to say, in an age of
  • Pretty child! your dress is sadly simple, and your hair seems almost as
  • Nature might have left it. But we can soon alter all that. A thoroughly
  • experienced French maid produces a really marvellous result in a very
  • brief space of time. I remember recommending one to young Lady Lancing,
  • and after three months her own husband did not know her.
  • Lady Bracknell. [Glares at Jack for a few moments. Then bends, with a
  • practised smile, to Cecily.] Kindly turn round, sweet child. [Cecily
  • turns completely round.] No, the side view is what I want. [Cecily
  • presents her profile.] Yes, quite as I expected. There are distinct
  • social possibilities in your profile. The two weak points in our age are
  • its want of principle and its want of profile. The chin a little higher,
  • very high, just at present. Algernon!
  • Lady Bracknell. There are distinct social possibilities in Miss Cardew's
  • Lady Bracknell. Never speak disrespectfully of Society, Algernon. Only
  • people who can't get into it do that. [To Cecily.] Dear child, of
  • course you know that Algernon has nothing but his debts to depend upon.
  • But I do not approve of mercenary marriages. When I married Lord
  • Bracknell I had no fortune of any kind. But I never dreamed for a moment
  • of allowing that to stand in my way. Well, I suppose I must give my
  • Lady Bracknell. Cecily, you may kiss me!
  • Lady Bracknell. You may also address me as Aunt Augusta for the future.
  • Lady Bracknell. The marriage, I think, had better take place quite soon.
  • Lady Bracknell. To speak frankly, I am not in favour of long
  • other's character before marriage, which I think is never advisable.
  • engagement is quite out of the question. I am Miss Cardew's guardian,
  • and she cannot marry without my consent until she comes of age. That
  • consent I absolutely decline to give.
  • Lady Bracknell. Upon what grounds may I ask? Algernon is an extremely,
  • I may almost say an ostentatiously, eligible young man. He has nothing,
  • but he looks everything. What more can one desire?
  • Bracknell, about your nephew, but the fact is that I do not approve at
  • all of his moral character. I suspect him of being untruthful. [Algernon
  • and Cecily look at him in indignant amazement.]
  • Lady Bracknell. Untruthful! My nephew Algernon? Impossible! He is an
  • afternoon during my temporary absence in London on an important question
  • of romance, he obtained admission to my house by means of the false
  • pretence of being my brother. Under an assumed name he drank, I've just
  • been informed by my butler, an entire pint bottle of my Perrier-Jouet,
  • Brut, '89; wine I was specially reserving for myself. Continuing his
  • disgraceful deception, he succeeded in the course of the afternoon in
  • alienating the affections of my only ward. He subsequently stayed to
  • tea, and devoured every single muffin. And what makes his conduct all
  • the more heartless is, that he was perfectly well aware from the first
  • that I have no brother, that I never had a brother, and that I don't
  • intend to have a brother, not even of any kind. I distinctly told him so
  • myself yesterday afternoon.
  • Lady Bracknell. Ahem! Mr. Worthing, after careful consideration I have
  • decided entirely to overlook my nephew's conduct to you.
  • however, is unalterable. I decline to give my consent.
  • Lady Bracknell. [To Cecily.] Come here, sweet child. [Cecily goes
  • when I go to evening parties.
  • Lady Bracknell. You are perfectly right in making some slight
  • but admitting to twenty at evening parties. Well, it will not be very
  • long before you are of age and free from the restraints of tutelage. So
  • I don't think your guardian's consent is, after all, a matter of any
  • is only fair to tell you that according to the terms of her grandfather's
  • will Miss Cardew does not come legally of age till she is thirty-five.
  • Lady Bracknell. That does not seem to me to be a grave objection. Thirty-
  • five is a very attractive age. London society is full of women of the
  • very highest birth who have, of their own free choice, remained thirty-
  • five for years. Lady Dumbleton is an instance in point. To my own
  • knowledge she has been thirty-five ever since she arrived at the age of
  • forty, which was many years ago now. I see no reason why our dear Cecily
  • should not be even still more attractive at the age you mention than she
  • is at present. There will be a large accumulation of property.
  • I hate waiting even five minutes for anybody. It always makes me rather
  • others, and waiting, even to be married, is quite out of the question.
  • Lady Bracknell. My dear Mr. Worthing, as Miss Cardew states positively
  • that she cannot wait till she is thirty-five--a remark which I am bound
  • to say seems to me to show a somewhat impatient nature--I would beg of
  • you to reconsider your decision.
  • gladly allow your nephew to form an alliance with my ward.
  • Lady Bracknell. [Rising and drawing herself up.] You must be quite
  • aware that what you propose is out of the question.
  • Lady Bracknell. That is not the destiny I propose for Gwendolen.
  • Algernon, of course, can choose for himself. [Pulls out her watch.]
  • Come, dear, [Gwendolen rises] we have already missed five, if not six,
  • [Enter Dr. Chasuble.]
  • Lady Bracknell. The christenings, sir! Is not that somewhat premature?
  • Both these gentlemen have expressed a desire for immediate baptism.
  • Lady Bracknell. At their age? The idea is grotesque and irreligious!
  • Algernon, I forbid you to be baptized. I will not hear of such excesses.
  • Lord Bracknell would be highly displeased if he learned that that was the
  • way in which you wasted your time and money.
  • at all this afternoon?
  • practical value to either of us, Dr. Chasuble.
  • They savour of the heretical views of the Anabaptists, views that I have
  • completely refuted in four of my unpublished sermons. However, as your
  • present mood seems to be one peculiarly secular, I will return to the
  • church at once. Indeed, I have just been informed by the pew-opener that
  • for the last hour and a half Miss Prism has been waiting for me in the
  • Lady Bracknell. [Starting.] Miss Prism! Did I hear you mention a Miss
  • Prism?
  • Lady Bracknell. Pray allow me to detain you for a moment. This matter
  • may prove to be one of vital importance to Lord Bracknell and myself. Is
  • this Miss Prism a female of repellent aspect, remotely connected with
  • education?
  • and the very picture of respectability.
  • Lady Bracknell. It is obviously the same person. May I ask what
  • position she holds in your household?
  • three years Miss Cardew's esteemed governess and valued companion.
  • Lady Bracknell. In spite of what I hear of her, I must see her at once.
  • Let her be sent for.
  • [Enter Miss Prism hurriedly.]
  • Miss Prism. I was told you expected me in the vestry, dear Canon. I
  • have been waiting for you there for an hour and three-quarters. [Catches
  • sight of Lady Bracknell, who has fixed her with a stony glare. Miss
  • Prism grows pale and quails. She looks anxiously round as if desirous to
  • Lady Bracknell. [In a severe, judicial voice.] Prism! [Miss Prism bows
  • her head in shame.] Come here, Prism! [Miss Prism approaches in a
  • humble manner.] Prism! Where is that baby? [General consternation. The
  • Canon starts back in horror. Algernon and Jack pretend to be anxious to
  • shield Cecily and Gwendolen from hearing the details of a terrible public
  • house, Number 104, Upper Grosvenor Street, in charge of a perambulator
  • that contained a baby of the male sex. You never returned. A few weeks
  • later, through the elaborate investigations of the Metropolitan police,
  • the perambulator was discovered at midnight, standing by itself in a
  • remote corner of Bayswater. It contained the manuscript of a
  • three-volume novel of more than usually revolting sentimentality. [Miss
  • Prism starts in involuntary indignation.] But the baby was not there!
  • [Every one looks at Miss Prism.] Prism! Where is that baby? [A pause.]
  • Miss Prism. Lady Bracknell, I admit with shame that I do not know. I
  • only wish I did. The plain facts of the case are these. On the morning
  • of the day you mention, a day that is for ever branded on my memory, I
  • prepared as usual to take the baby out in its perambulator. I had also
  • with me a somewhat old, but capacious hand-bag in which I had intended to
  • place the manuscript of a work of fiction that I had written during my
  • few unoccupied hours. In a moment of mental abstraction, for which I
  • never can forgive myself, I deposited the manuscript in the basinette,
  • and placed the baby in the hand-bag.
  • the hand-bag?
  • Miss Prism. Do not ask me, Mr. Worthing.
  • insist on knowing where you deposited the hand-bag that contained that
  • Miss Prism. I left it in the cloak-room of one of the larger railway
  • stations in London.
  • Miss Prism. [Quite crushed.] Victoria. The Brighton line. [Sinks into
  • a chair.]
  • Lady Bracknell. I dare not even suspect, Dr. Chasuble. I need hardly
  • tell you that in families of high position strange coincidences are not
  • supposed to occur. They are hardly considered the thing.
  • [Noises heard overhead as if some one was throwing trunks about. Every
  • one looks up.]
  • Lady Bracknell. This noise is extremely unpleasant. It sounds as if he
  • was having an argument. I dislike arguments of any kind. They are
  • always vulgar, and often convincing.
  • Lady Bracknell. I wish he would arrive at some conclusion.
  • with a hand-bag of black leather in his hand.]
  • Examine it carefully before you speak. The happiness of more than one
  • life depends on your answer.
  • Miss Prism. [Calmly.] It seems to be mine. Yes, here is the injury it
  • received through the upsetting of a Gower Street omnibus in younger and
  • happier days. Here is the stain on the lining caused by the explosion of
  • a temperance beverage, an incident that occurred at Leamington. And
  • here, on the lock, are my initials. I had forgotten that in an
  • extravagant mood I had had them placed there. The bag is undoubtedly
  • been a great inconvenience being without it all these years.
  • this hand-bag. I was the baby you placed in it.
  • Miss Prism. [Amazed.] You?
  • Miss Prism. [Recoiling in indignant astonishment.] Mr. Worthing! I am
  • unmarried!
  • who has the right to cast a stone against one who has suffered? Cannot
  • repentance wipe out an act of folly? Why should there be one law for
  • men, and another for women? Mother, I forgive you. [Tries to embrace
  • her again.]
  • Miss Prism. [Still more indignant.] Mr. Worthing, there is some error.
  • [Pointing to Lady Bracknell.] There is the lady who can tell you who you
  • really are.
  • would you kindly inform me who I am?
  • Lady Bracknell. I am afraid that the news I have to give you will not
  • altogether please you. You are the son of my poor sister, Mrs.
  • Moncrieff, and consequently Algernon's elder brother.
  • had a brother! I always said I had a brother! Cecily,--how could you
  • have ever doubted that I had a brother? [Seizes hold of Algernon.] Dr.
  • Chasuble, my unfortunate brother. Miss Prism, my unfortunate brother.
  • Gwendolen, my unfortunate brother. Algy, you young scoundrel, you will
  • have to treat me with more respect in the future. You have never behaved
  • to me like a brother in all your life.
  • however, though I was out of practice.
  • [Shakes hands.]
  • Christian name, now that you have become some one else?
  • decision on the subject of my name is irrevocable, I suppose?
  • a moment. At the time when Miss Prism left me in the hand-bag, had I
  • been christened already?
  • Lady Bracknell. Every luxury that money could buy, including
  • christening, had been lavished on you by your fond and doting parents.
  • given? Let me know the worst.
  • Lady Bracknell. Being the eldest son you were naturally christened after
  • your father.
  • Lady Bracknell. [Meditatively.] I cannot at the present moment recall
  • what the General's Christian name was. But I have no doubt he had one.
  • He was eccentric, I admit. But only in later years. And that was the
  • result of the Indian climate, and marriage, and indigestion, and other
  • things of that kind.
  • before I was a year old.
  • Aunt Augusta?
  • Lady Bracknell. The General was essentially a man of peace, except in
  • his domestic life. But I have no doubt his name would appear in any
  • military directory.
  • records should have been my constant study. [Rushes to bookcase and
  • tears the books out.] M. Generals . . . Mallam, Maxbohm, Magley, what
  • ghastly names they have--Markby, Migsby, Mobbs, Moncrieff! Lieutenant
  • 1840, Captain, Lieutenant-Colonel, Colonel, General 1869, Christian
  • names, Ernest John. [Puts book very quietly down and speaks quite
  • Well, it is Ernest after all. I mean it naturally is Ernest.
  • Lady Bracknell. Yes, I remember now that the General was called Ernest,
  • I knew I had some particular reason for disliking the name.
  • have no other name!
  • that all his life he has been speaking nothing but the truth. Can you
  • forgive me?
  • Miss Prism. [Enthusiastically.] Frederick! At last!
  • Lady Bracknell. My nephew, you seem to be displaying signs of
  • time in my life the vital Importance of Being Earnest.
  • TABLEAU
  • Algernon. Did you hear what I was playing, Lane?
  • Lane. I didn't think it polite to listen, sir.
  • Algernon. I'm sorry for that, for your sake. I don't play
  • Lane. Yes, sir.
  • Algernon. And, speaking of the science of Life, have you got the
  • Lane. Yes, sir. [Hands them on a salver.]
  • Algernon. [Inspects them, takes two, and sits down on the sofa.] Oh! . . .
  • Lane. Yes, sir; eight bottles and a pint.
  • Algernon. Why is it that at a bachelor's establishment the servants
  • Lane. I attribute it to the superior quality of the wine, sir. I have
  • Algernon. Good heavens! Is marriage so demoralising as that?
  • Lane. I believe it _is_ a very pleasant state, sir. I have had very
  • Algernon. [Languidly_._] I don't know that I am much interested in your
  • Lane. No, sir; it is not a very interesting subject. I never think of
  • Algernon. Very natural, I am sure. That will do, Lane, thank you.
  • Lane. Thank you, sir. [Lane goes out.]
  • Algernon. Lane's views on marriage seem somewhat lax. Really, if the
  • Lane. Mr. Ernest Worthing.
  • Algernon. How are you, my dear Ernest? What brings you up to town?
  • Jack. Oh, pleasure, pleasure! What else should bring one anywhere?
  • Algernon. [Stiffly_._] I believe it is customary in good society to
  • Jack. [Sitting down on the sofa.] In the country.
  • Algernon. What on earth do you do there?
  • Jack. [Pulling off his gloves_._] When one is in town one amuses
  • Algernon. And who are the people you amuse?
  • Jack. [Airily_._] Oh, neighbours, neighbours.
  • Algernon. Got nice neighbours in your part of Shropshire?
  • Jack. Perfectly horrid! Never speak to one of them.
  • Algernon. How immensely you must amuse them! [Goes over and takes
  • Jack. Eh? Shropshire? Yes, of course. Hallo! Why all these cups? Why
  • Algernon. Oh! merely Aunt Augusta and Gwendolen.
  • Jack. How perfectly delightful!
  • Algernon. Yes, that is all very well; but I am afraid Aunt Augusta won't
  • Jack. May I ask why?
  • Algernon. My dear fellow, the way you flirt with Gwendolen is perfectly
  • Jack. I am in love with Gwendolen. I have come up to town expressly to
  • Algernon. I thought you had come up for pleasure? . . . I call that
  • Jack. How utterly unromantic you are!
  • Algernon. I really don't see anything romantic in proposing. It is very
  • Jack. I have no doubt about that, dear Algy. The Divorce Court was
  • Algernon. Oh! there is no use speculating on that subject. Divorces are
  • Jack. Well, you have been eating them all the time.
  • Algernon. That is quite a different matter. She is my aunt. [Takes
  • Jack. [Advancing to table and helping himself.] And very good bread and
  • Algernon. Well, my dear fellow, you need not eat as if you were going to
  • Jack. Why on earth do you say that?
  • Algernon. Well, in the first place girls never marry the men they flirt
  • Jack. Oh, that is nonsense!
  • Algernon. It isn't. It is a great truth. It accounts for the
  • Jack. Your consent!
  • Algernon. My dear fellow, Gwendolen is my first cousin. And before I
  • Cecily. [Rings bell.]
  • Jack. Cecily! What on earth do you mean? What do you mean, Algy, by
  • Algernon. Bring me that cigarette case Mr. Worthing left in the smoking-
  • Lane. Yes, sir. [Lane goes out.]
  • Jack. Do you mean to say you have had my cigarette case all this time? I
  • Algernon. Well, I wish you would offer one. I happen to be more than
  • Jack. There is no good offering a large reward now that the thing is
  • Algernon. I think that is rather mean of you, Ernest, I must say. [Opens
  • Jack. Of course it's mine. [Moving to him.] You have seen me with it a
  • Algernon. Oh! it is absurd to have a hard and fast rule about what one
  • Jack. I am quite aware of the fact, and I don't propose to discuss
  • Algernon. Yes; but this isn't your cigarette case. This cigarette case
  • Jack. Well, if you want to know, Cecily happens to be my aunt.
  • Algernon. Your aunt!
  • Jack. Yes. Charming old lady she is, too. Lives at Tunbridge Wells.
  • Algernon. [Retreating to back of sofa.] But why does she call herself
  • Jack. [Moving to sofa and kneeling upon it.] My dear fellow, what on
  • Algernon. Yes. But why does your aunt call you her uncle? 'From little
  • Ernest.
  • Jack. It isn't Ernest; it's Jack.
  • Algernon. You have always told me it was Ernest. I have introduced you
  • Ernest. It's on your cards. Here is one of them. [Taking it from
  • Jack. Well, my name is Ernest in town and Jack in the country, and the
  • Algernon. Yes, but that does not account for the fact that your small
  • Jack. My dear Algy, you talk exactly as if you were a dentist. It is
  • Algernon. Well, that is exactly what dentists always do. Now, go on!
  • Jack. Bunburyist? What on earth do you mean by a Bunburyist?
  • Algernon. I'll reveal to you the meaning of that incomparable expression
  • Jack. Well, produce my cigarette case first.
  • Algernon. Here it is. [Hands cigarette case.] Now produce your
  • Jack. My dear fellow, there is nothing improbable about my explanation
  • Algernon. Where is that place in the country, by the way?
  • Jack. That is nothing to you, dear boy. You are not going to be invited
  • Algernon. I suspected that, my dear fellow! I have Bunburyed all over
  • Jack. My dear Algy, I don't know whether you will be able to understand
  • Algernon. The truth is rarely pure and never simple. Modern life would
  • Jack. That wouldn't be at all a bad thing.
  • Algernon. Literary criticism is not your forte, my dear fellow. Don't
  • University. They do it so well in the daily papers. What you really are
  • Jack. What on earth do you mean?
  • Algernon. You have invented a very useful younger brother called Ernest,
  • Jack. I haven't asked you to dine with me anywhere to-night.
  • Algernon. I know. You are absurdly careless about sending out
  • Jack. You had much better dine with your Aunt Augusta.
  • Algernon. I haven't the smallest intention of doing anything of the
  • Jack. I'm not a Bunburyist at all. If Gwendolen accepts me, I am going
  • Algernon. Nothing will induce me to part with Bunbury, and if you ever
  • Jack. That is nonsense. If I marry a charming girl like Gwendolen, and
  • Algernon. Then your wife will. You don't seem to realise, that in
  • Jack. [Sententiously.] That, my dear young friend, is the theory that
  • Algernon. Yes; and that the happy English home has proved in half the
  • Jack. For heaven's sake, don't try to be cynical. It's perfectly easy
  • Algernon. My dear fellow, it isn't easy to be anything nowadays. There's
  • Jack. I suppose so, if you want to.
  • Algernon. Yes, but you must be serious about it. I hate people who are
  • Lane. Lady Bracknell and Miss Fairfax.
  • Gwendolen.]
  • Algernon. I'm feeling very well, Aunt Augusta.
  • Algernon. [To Gwendolen.] Dear me, you are smart!
  • Gwendolen. I am always smart! Am I not, Mr. Worthing?
  • Jack. You're quite perfect, Miss Fairfax.
  • Gwendolen. Oh! I hope I am not that. It would leave no room for
  • Algernon. Certainly, Aunt Augusta. [Goes over to tea-table.]
  • Gwendolen. Thanks, mamma, I'm quite comfortable where I am.
  • Algernon. [Picking up empty plate in horror.] Good heavens! Lane! Why
  • Lane. [Gravely.] There were no cucumbers in the market this morning,
  • Algernon. No cucumbers!
  • Lane. No, sir. Not even for ready money.
  • Algernon. That will do, Lane, thank you.
  • Lane. Thank you, sir. [Goes out.]
  • Algernon. I am greatly distressed, Aunt Augusta, about there being no
  • Algernon. I hear her hair has turned quite gold from grief.
  • Algernon. I am afraid, Aunt Augusta, I shall have to give up the
  • Algernon. It is a great bore, and, I need hardly say, a terrible
  • Jack.] They seem to think I should be with him.
  • Algernon. Yes; poor Bunbury is a dreadful invalid.
  • Algernon. I'll speak to Bunbury, Aunt Augusta, if he is still conscious,
  • Gwendolen. Certainly, mamma.
  • Jack. Charming day it has been, Miss Fairfax.
  • Gwendolen. Pray don't talk to me about the weather, Mr. Worthing.
  • Jack. I do mean something else.
  • Gwendolen. I thought so. In fact, I am never wrong.
  • Jack. And I would like to be allowed to take advantage of Lady
  • Gwendolen. I would certainly advise you to do so. Mamma has a way of
  • Jack. [Nervously.] Miss Fairfax, ever since I met you I have admired
  • Gwendolen. Yes, I am quite well aware of the fact. And I often wish
  • Jack. You really love me, Gwendolen?
  • Gwendolen. Passionately!
  • Jack. Darling! You don't know how happy you've made me.
  • Gwendolen. My own Ernest!
  • Jack. But you don't really mean to say that you couldn't love me if my
  • Gwendolen. But your name is Ernest.
  • Jack. Yes, I know it is. But supposing it was something else? Do you
  • Gwendolen. [Glibly.] Ah! that is clearly a metaphysical speculation,
  • Jack. Personally, darling, to speak quite candidly, I don't much care
  • Gwendolen. It suits you perfectly. It is a divine name. It has a music
  • Jack. Well, really, Gwendolen, I must say that I think there are lots of
  • Gwendolen. Jack? . . . No, there is very little music in the name Jack,
  • Ernest.
  • Jack. Gwendolen, I must get christened at once--I mean we must get
  • Gwendolen. Married, Mr. Worthing?
  • Jack. [Astounded.] Well . . . surely. You know that I love you, and
  • Gwendolen. I adore you. But you haven't proposed to me yet. Nothing
  • Jack. Well . . . may I propose to you now?
  • Gwendolen. I think it would be an admirable opportunity. And to spare
  • Jack. Gwendolen!
  • Gwendolen. Yes, Mr. Worthing, what have you got to say to me?
  • Jack. You know what I have got to say to you.
  • Gwendolen. Yes, but you don't say it.
  • Jack. Gwendolen, will you marry me? [Goes on his knees.]
  • Gwendolen. Of course I will, darling. How long you have been about it!
  • Jack. My own one, I have never loved any one in the world but you.
  • Gwendolen. Yes, but men often propose for practice. I know my brother
  • Gwendolen. Mamma! [He tries to rise; she restrains him.] I must beg
  • Gwendolen. I am engaged to Mr. Worthing, mamma. [They rise together.]
  • Gwendolen. [Reproachfully.] Mamma!
  • Gwendolen. Yes, mamma. [Goes out, looking back at Jack.]
  • Jack. Thank you, Lady Bracknell, I prefer standing.
  • Jack. Well, yes, I must admit I smoke.
  • Jack. Twenty-nine.
  • Jack. [After some hesitation.] I know nothing, Lady Bracknell.
  • Jack. Between seven and eight thousand a year.
  • Jack. In investments, chiefly.
  • Jack. I have a country house with some land, of course, attached to it,
  • Jack. Well, I own a house in Belgrave Square, but it is let by the year
  • Jack. Oh, she goes about very little. She is a lady considerably
  • Jack. 149.
  • Jack. Do you mean the fashion, or the side?
  • Jack. Well, I am afraid I really have none. I am a Liberal Unionist.
  • Jack. I have lost both my parents.
  • Jack. I am afraid I really don't know. The fact is, Lady Bracknell, I
  • Jack. The late Mr. Thomas Cardew, an old gentleman of a very charitable
  • Jack. [Gravely.] In a hand-bag.
  • Jack. [Very seriously.] Yes, Lady Bracknell. I was in a hand-bag--a
  • Jack. In the cloak-room at Victoria Station. It was given to him in
  • Jack. Yes. The Brighton line.
  • Jack. May I ask you then what you would advise me to do? I need hardly
  • Jack. Well, I don't see how I could possibly manage to do that. I can
  • Jack. Good morning! [Algernon, from the other room, strikes up the
  • Algernon. Didn't it go off all right, old boy? You don't mean to say
  • Jack. Oh, Gwendolen is as right as a trivet. As far as she is
  • Algernon. My dear boy, I love hearing my relations abused. It is the
  • Jack. Oh, that is nonsense!
  • Algernon. It isn't!
  • Jack. Well, I won't argue about the matter. You always want to argue
  • Algernon. That is exactly what things were originally made for.
  • Jack. Upon my word, if I thought that, I'd shoot myself . . . [A pause.]
  • Algernon. All women become like their mothers. That is their tragedy.
  • Jack. Is that clever?
  • Algernon. It is perfectly phrased! and quite as true as any observation
  • Jack. I am sick to death of cleverness. Everybody is clever nowadays.
  • Algernon. We have.
  • Jack. I should extremely like to meet them. What do they talk about?
  • Algernon. The fools? Oh! about the clever people, of course.
  • Jack. What fools!
  • Algernon. By the way, did you tell Gwendolen the truth about your being
  • Jack. [In a very patronising manner.] My dear fellow, the truth isn't
  • Algernon. The only way to behave to a woman is to make love to her, if
  • Jack. Oh, that is nonsense.
  • Algernon. What about your brother? What about the profligate Ernest?
  • Jack. Oh, before the end of the week I shall have got rid of him. I'll
  • Algernon. Yes, but it's hereditary, my dear fellow. It's a sort of
  • Jack. You are sure a severe chill isn't hereditary, or anything of that
  • Algernon. Of course it isn't!
  • Jack. Very well, then. My poor brother Ernest to carried off suddenly,
  • Algernon. But I thought you said that . . . Miss Cardew was a little too
  • Jack. Oh, that is all right. Cecily is not a silly romantic girl, I am
  • Algernon. I would rather like to see Cecily.
  • Jack. I will take very good care you never do. She is excessively
  • Algernon. Have you told Gwendolen yet that you have an excessively
  • Jack. Oh! one doesn't blurt these things out to people. Cecily and
  • Algernon. Women only do that when they have called each other a lot of
  • Jack. [Irritably.] Oh! It always is nearly seven.
  • Algernon. Well, I'm hungry.
  • Jack. I never knew you when you weren't . . .
  • Algernon. What shall we do after dinner? Go to a theatre?
  • Jack. Oh no! I loathe listening.
  • Algernon. Well, let us go to the Club?
  • Jack. Oh, no! I hate talking.
  • Algernon. Well, we might trot round to the Empire at ten?
  • Jack. Oh, no! I can't bear looking at things. It is so silly.
  • Algernon. Well, what shall we do?
  • Jack. Nothing!
  • Algernon. It is awfully hard work doing nothing. However, I don't mind
  • Lane. Miss Fairfax.
  • Algernon. Gwendolen, upon my word!
  • Gwendolen. Algy, kindly turn your back. I have something very
  • Algernon. Really, Gwendolen, I don't think I can allow this at all.
  • Gwendolen. Algy, you always adopt a strictly immoral attitude towards
  • Jack. My own darling!
  • Gwendolen. Ernest, we may never be married. From the expression on
  • Jack. Dear Gwendolen!
  • Gwendolen. The story of your romantic origin, as related to me by mamma,
  • Jack. The Manor House, Woolton, Hertfordshire.
  • Gwendolen. There is a good postal service, I suppose? It may be
  • Jack. My own one!
  • Gwendolen. How long do you remain in town?
  • Jack. Till Monday.
  • Gwendolen. Good! Algy, you may turn round now.
  • Algernon. Thanks, I've turned round already.
  • Gwendolen. You may also ring the bell.
  • Jack. You will let me see you to your carriage, my own darling?
  • Gwendolen. Certainly.
  • Jack. [To Lane, who now enters.] I will see Miss Fairfax out.
  • Lane. Yes, sir. [Jack and Gwendolen go off.]
  • Algernon. A glass of sherry, Lane.
  • Lane. Yes, sir.
  • Algernon. To-morrow, Lane, I'm going Bunburying.
  • Lane. Yes, sir.
  • Algernon. I shall probably not be back till Monday. You can put up my
  • Lane. Yes, sir. [Handing sherry.]
  • Algernon. I hope to-morrow will be a fine day, Lane.
  • Lane. It never is, sir.
  • Algernon. Lane, you're a perfect pessimist.
  • Lane. I do my best to give satisfaction, sir.
  • Jack. There's a sensible, intellectual girl! the only girl I ever cared
  • Algernon. Oh, I'm a little anxious about poor Bunbury, that is all.
  • Jack. If you don't take care, your friend Bunbury will get you into a
  • Algernon. I love scrapes. They are the only things that are never
  • Jack. Oh, that's nonsense, Algy. You never talk anything but nonsense.
  • Algernon. Nobody ever does.
  • July. Basket chairs, and a table covered with books, are set under a
  • Cecily. [Coming over very slowly.] But I don't like German. It isn't
  • Cecily. Dear Uncle Jack is so very serious! Sometimes he is so serious
  • Cecily. I suppose that is why he often looks a little bored when we
  • Cecily. I wish Uncle Jack would allow that unfortunate young man, his
  • Cecily. I keep a diary in order to enter the wonderful secrets of my
  • Cecily. Yes, but it usually chronicles the things that have never
  • Cecily. Did you really, Miss Prism? How wonderfully clever you are! I
  • Cecily. I suppose so. But it seems very unfair. And was your novel
  • Cecily. [Smiling.] But I see dear Dr. Chasuble coming up through the
  • Chasuble. And how are we this morning? Miss Prism, you are, I trust,
  • Cecily. Miss Prism has just been complaining of a slight headache. I
  • Cecily. No, dear Miss Prism, I know that, but I felt instinctively that
  • Chasuble. I hope, Cecily, you are not inattentive.
  • Cecily. Oh, I am afraid I am.
  • Chasuble. That is strange. Were I fortunate enough to be Miss Prism's
  • Chasuble. Ah yes, he usually likes to spend his Sunday in London. He is
  • Chasuble. [Bowing.] A classical allusion merely, drawn from the Pagan
  • Chasuble. With pleasure, Miss Prism, with pleasure. We might go as far
  • Cecily. [Picks up books and throws them back on table.] Horrid
  • Merriman. Mr. Ernest Worthing has just driven over from the station. He
  • Cecily. [Takes the card and reads it.] 'Mr. Ernest Worthing, B. 4, The
  • Merriman. Yes, Miss. He seemed very much disappointed. I mentioned
  • Cecily. Ask Mr. Ernest Worthing to come here. I suppose you had better
  • Merriman. Yes, Miss.
  • Cecily. I have never met any really wicked person before. I feel rather
  • Algernon. [Raising his hat.] You are my little cousin Cecily, I'm sure.
  • Cecily. You are under some strange mistake. I am not little. In fact,
  • Algernon. Oh! I am not really wicked at all, cousin Cecily. You mustn't
  • Cecily. If you are not, then you have certainly been deceiving us all in
  • Algernon. [Looks at her in amazement.] Oh! Of course I have been
  • Cecily. I am glad to hear it.
  • Algernon. In fact, now you mention the subject, I have been very bad in
  • Cecily. I don't think you should be so proud of that, though I am sure
  • Algernon. It is much pleasanter being here with you.
  • Cecily. I can't understand how you are here at all. Uncle Jack won't be
  • Algernon. That is a great disappointment. I am obliged to go up by the
  • Cecily. Couldn't you miss it anywhere but in London?
  • Algernon. No: the appointment is in London.
  • Cecily. Well, I know, of course, how important it is not to keep a
  • Algernon. About my what?
  • Cecily. Your emigrating. He has gone up to buy your outfit.
  • Algernon. I certainly wouldn't let Jack buy my outfit. He has no taste
  • Cecily. I don't think you will require neckties. Uncle Jack is sending
  • Algernon. Australia! I'd sooner die.
  • Cecily. Well, he said at dinner on Wednesday night, that you would have
  • Algernon. Oh, well! The accounts I have received of Australia and the
  • Cecily. Yes, but are you good enough for it?
  • Algernon. I'm afraid I'm not that. That is why I want you to reform me.
  • Cecily. I'm afraid I've no time, this afternoon.
  • Algernon. Well, would you mind my reforming myself this afternoon?
  • Cecily. It is rather Quixotic of you. But I think you should try.
  • Algernon. I will. I feel better already.
  • Cecily. You are looking a little worse.
  • Algernon. That is because I am hungry.
  • Cecily. How thoughtless of me. I should have remembered that when one
  • Algernon. Thank you. Might I have a buttonhole first? I never have any
  • Cecily. A Marechal Niel? [Picks up scissors.]
  • Algernon. No, I'd sooner have a pink rose.
  • Cecily. Why? [Cuts a flower.]
  • Algernon. Because you are like a pink rose, Cousin Cecily.
  • Cecily. I don't think it can be right for you to talk to me like that.
  • Algernon. Then Miss Prism is a short-sighted old lady. [Cecily puts the
  • Cecily. Miss Prism says that all good looks are a snare.
  • Algernon. They are a snare that every sensible man would like to be
  • Cecily. Oh, I don't think I would care to catch a sensible man. I
  • Chasuble. [With a scholar's shudder.] Believe me, I do not deserve so
  • Chasuble. But is a man not equally attractive when married?
  • Chasuble. And often, I've been told, not even to her.
  • Chasuble. Perhaps she followed us to the schools.
  • Chasuble. Mr. Worthing?
  • Jack. [Shakes Miss Prism's hand in a tragic manner.] I have returned
  • Chasuble. Dear Mr. Worthing, I trust this garb of woe does not betoken
  • Jack. My brother.
  • Chasuble. Still leading his life of pleasure?
  • Jack. [Shaking his head.] Dead!
  • Chasuble. Your brother Ernest dead?
  • Jack. Quite dead.
  • Chasuble. Mr. Worthing, I offer you my sincere condolence. You have at
  • Jack. Poor Ernest! He had many faults, but it is a sad, sad blow.
  • Chasuble. Very sad indeed. Were you with him at the end?
  • Jack. No. He died abroad; in Paris, in fact. I had a telegram last
  • Chasuble. Was the cause of death mentioned?
  • Jack. A severe chill, it seems.
  • Chasuble. [Raising his hand.] Charity, dear Miss Prism, charity! None
  • Jack. No. He seems to have expressed a desire to be buried in Paris.
  • Chasuble. In Paris! [Shakes his head.] I fear that hardly points to
  • Sunday. [Jack presses his hand convulsively.] My sermon on the meaning
  • Jack. Ah! that reminds me, you mentioned christenings I think, Dr.
  • Chasuble. But is there any particular infant in whom you are interested,
  • Mr. Worthing? Your brother was, I believe, unmarried, was he not?
  • Jack. Oh yes.
  • Jack. But it is not for any child, dear Doctor. I am very fond of
  • Chasuble. But surely, Mr. Worthing, you have been christened already?
  • Jack. I don't remember anything about it.
  • Chasuble. But have you any grave doubts on the subject?
  • Jack. I certainly intend to have. Of course I don't know if the thing
  • Chasuble. Not at all. The sprinkling, and, indeed, the immersion of
  • Jack. Immersion!
  • Chasuble. You need have no apprehensions. Sprinkling is all that is
  • Jack. Oh, I might trot round about five if that would suit you.
  • Chasuble. Perfectly, perfectly! In fact I have two similar ceremonies
  • Jack. Oh! I don't see much fun in being christened along with other
  • Chasuble. Admirably! Admirably! [Takes out watch.] And now, dear Mr.
  • Cecily. Uncle Jack! Oh, I am pleased to see you back. But what horrid
  • Chasuble. My child! my child! [Cecily goes towards Jack; he kisses her
  • Cecily. What is the matter, Uncle Jack? Do look happy! You look as if
  • Jack. Who?
  • Cecily. Your brother Ernest. He arrived about half an hour ago.
  • Jack. What nonsense! I haven't got a brother.
  • Cecily. Oh, don't say that. However badly he may have behaved to you in
  • Chasuble. These are very joyful tidings.
  • Jack. My brother is in the dining-room? I don't know what it all means.
  • Jack. Good heavens! [Motions Algernon away.]
  • Algernon. Brother John, I have come down from town to tell you that I am
  • Cecily. Uncle Jack, you are not going to refuse your own brother's hand?
  • Jack. Nothing will induce me to take his hand. I think his coming down
  • Cecily. Uncle Jack, do be nice. There is some good in every one. Ernest
  • Jack. Oh! he has been talking about Bunbury, has he?
  • Cecily. Yes, he has told me all about poor Mr. Bunbury, and his terrible
  • Jack. Bunbury! Well, I won't have him talk to you about Bunbury or
  • Algernon. Of course I admit that the faults were all on my side. But I
  • Cecily. Uncle Jack, if you don't shake hands with Ernest I will never
  • Jack. Never forgive me?
  • Cecily. Never, never, never!
  • Jack. Well, this is the last time I shall ever do it. [Shakes with
  • Chasuble. It's pleasant, is it not, to see so perfect a reconciliation?
  • Cecily. Certainly, Miss Prism. My little task of reconciliation is
  • Chasuble. You have done a beautiful action to-day, dear child.
  • Cecily. I feel very happy. [They all go off except Jack and Algernon.]
  • Jack. You young scoundrel, Algy, you must get out of this place as soon
  • Merriman. I have put Mr. Ernest's things in the room next to yours, sir.
  • Jack. What?
  • Merriman. Mr. Ernest's luggage, sir. I have unpacked it and put it in
  • Jack. His luggage?
  • Merriman. Yes, sir. Three portmanteaus, a dressing-case, two hat-boxes,
  • Algernon. I am afraid I can't stay more than a week this time.
  • Jack. Merriman, order the dog-cart at once. Mr. Ernest has been
  • Merriman. Yes, sir. [Goes back into the house.]
  • Algernon. What a fearful liar you are, Jack. I have not been called
  • Jack. Yes, you have.
  • Algernon. I haven't heard any one call me.
  • Jack. Your duty as a gentleman calls you back.
  • Algernon. My duty as a gentleman has never interfered with my pleasures
  • Jack. I can quite understand that.
  • Algernon. Well, Cecily is a darling.
  • Jack. You are not to talk of Miss Cardew like that. I don't like it.
  • Algernon. Well, I don't like your clothes. You look perfectly
  • Jack. You are certainly not staying with me for a whole week as a guest
  • Algernon. I certainly won't leave you so long as you are in mourning. It
  • Jack. Well, will you go if I change my clothes?
  • Algernon. Yes, if you are not too long. I never saw anybody take so
  • Jack. Well, at any rate, that is better than being always over-dressed
  • Algernon. If I am occasionally a little over-dressed, I make up for it
  • Jack. Your vanity is ridiculous, your conduct an outrage, and your
  • Algernon. I think it has been a great success. I'm in love with Cecily,
  • Cecily. Oh, I merely came back to water the roses. I thought you were
  • Algernon. He's gone to order the dog-cart for me.
  • Cecily. Oh, is he going to take you for a nice drive?
  • Algernon. He's going to send me away.
  • Cecily. Then have we got to part?
  • Algernon. I am afraid so. It's a very painful parting.
  • Cecily. It is always painful to part from people whom one has known for
  • Algernon. Thank you.
  • Merriman. The dog-cart is at the door, sir. [Algernon looks appealingly
  • Cecily. It can wait, Merriman for . . . five minutes.
  • Merriman. Yes, Miss. [Exit Merriman.]
  • Algernon. I hope, Cecily, I shall not offend you if I state quite
  • Cecily. I think your frankness does you great credit, Ernest. If you
  • Algernon. Do you really keep a diary? I'd give anything to look at it.
  • Cecily. Oh no. [Puts her hand over it.] You see, it is simply a very
  • Algernon. [Somewhat taken aback.] Ahem! Ahem!
  • Cecily. Oh, don't cough, Ernest. When one is dictating one should speak
  • Algernon. [Speaking very rapidly.] Cecily, ever since I first looked
  • Cecily. I don't think that you should tell me that you love me wildly,
  • Algernon. Cecily!
  • Merriman. The dog-cart is waiting, sir.
  • Algernon. Tell it to come round next week, at the same hour.
  • Merriman. [Looks at Cecily, who makes no sign.] Yes, sir.
  • Cecily. Uncle Jack would be very much annoyed if he knew you were
  • Algernon. Oh, I don't care about Jack. I don't care for anybody in the
  • Cecily. You silly boy! Of course. Why, we have been engaged for the
  • Algernon. For the last three months?
  • Cecily. Yes, it will be exactly three months on Thursday.
  • Algernon. But how did we become engaged?
  • Cecily. Well, ever since dear Uncle Jack first confessed to us that he
  • Algernon. Darling! And when was the engagement actually settled?
  • Cecily. On the 14th of February last. Worn out by your entire ignorance
  • Algernon. Did I give you this? It's very pretty, isn't it?
  • Cecily. Yes, you've wonderfully good taste, Ernest. It's the excuse
  • Algernon. My letters! But, my own sweet Cecily, I have never written
  • Cecily. You need hardly remind me of that, Ernest. I remember only too
  • Algernon. Oh, do let me read them, Cecily?
  • Cecily. Oh, I couldn't possibly. They would make you far too conceited.
  • Algernon. But was our engagement ever broken off?
  • Cecily. Of course it was. On the 22nd of last March. You can see the
  • Ernest. I feel it is better to do so. The weather still continues
  • Algernon. But why on earth did you break it off? What had I done? I
  • Cecily. It would hardly have been a really serious engagement if it
  • Algernon. [Crossing to her, and kneeling.] What a perfect angel you
  • Cecily. You dear romantic boy. [He kisses her, she puts her fingers
  • Algernon. Yes, darling, with a little help from others.
  • Cecily. I am so glad.
  • Algernon. You'll never break off our engagement again, Cecily?
  • Cecily. I don't think I could break it off now that I have actually met
  • Algernon. Yes, of course. [Nervously.]
  • Cecily. You must not laugh at me, darling, but it had always been a
  • Algernon. But, my dear child, do you mean to say you could not love me
  • Cecily. But what name?
  • Algernon. Oh, any name you like--Algernon--for instance . . .
  • Cecily. But I don't like the name of Algernon.
  • Algernon. Well, my own dear, sweet, loving little darling, I really
  • Cecily. [Rising.] I might respect you, Ernest, I might admire your
  • Algernon. Ahem! Cecily! [Picking up hat.] Your Rector here is, I
  • Cecily. Oh, yes. Dr. Chasuble is a most learned man. He has never
  • Algernon. I must see him at once on a most important christening--I mean
  • Cecily. Oh!
  • Algernon. I shan't be away more than half an hour.
  • Cecily. Considering that we have been engaged since February the 14th,
  • Algernon. I'll be back in no time.
  • Cecily. What an impetuous boy he is! I like his hair so much. I must
  • Merriman. A Miss Fairfax has just called to see Mr. Worthing. On very
  • Cecily. Isn't Mr. Worthing in his library?
  • Merriman. Mr. Worthing went over in the direction of the Rectory some
  • Cecily. Pray ask the lady to come out here; Mr. Worthing is sure to be
  • Merriman. Yes, Miss. [Goes out.]
  • Cecily. Miss Fairfax! I suppose one of the many good elderly women who
  • London. I don't quite like women who are interested in philanthropic
  • Merriman. Miss Fairfax.
  • Cecily. [Advancing to meet her.] Pray let me introduce myself to you.
  • Gwendolen. Cecily Cardew? [Moving to her and shaking hands.] What a
  • Cecily. How nice of you to like me so much after we have known each
  • Gwendolen. [Still standing up.] I may call you Cecily, may I not?
  • Cecily. With pleasure!
  • Gwendolen. And you will always call me Gwendolen, won't you?
  • Cecily. If you wish.
  • Gwendolen. Then that is all quite settled, is it not?
  • Cecily. I hope so. [A pause. They both sit down together.]
  • Gwendolen. Perhaps this might be a favourable opportunity for my
  • Cecily. I don't think so.
  • Gwendolen. Outside the family circle, papa, I am glad to say, is
  • Cecily. Oh! not at all, Gwendolen. I am very fond of being looked at.
  • Gwendolen. [After examining Cecily carefully through a lorgnette.] You
  • Cecily. Oh no! I live here.
  • Gwendolen. [Severely.] Really? Your mother, no doubt, or some female
  • Cecily. Oh no! I have no mother, nor, in fact, any relations.
  • Gwendolen. Indeed?
  • Cecily. My dear guardian, with the assistance of Miss Prism, has the
  • Gwendolen. Your guardian?
  • Cecily. Yes, I am Mr. Worthing's ward.
  • Gwendolen. Oh! It is strange he never mentioned to me that he had a
  • Cecily. Pray do! I think that whenever one has anything unpleasant to
  • Gwendolen. Well, to speak with perfect candour, Cecily, I wish that you
  • Cecily. I beg your pardon, Gwendolen, did you say Ernest?
  • Gwendolen. Yes.
  • Cecily. Oh, but it is not Mr. Ernest Worthing who is my guardian. It is
  • Gwendolen. [Sitting down again.] Ernest never mentioned to me that he
  • Cecily. I am sorry to say they have not been on good terms for a long
  • Gwendolen. Ah! that accounts for it. And now that I think of it I have
  • Cecily. Quite sure. [A pause.] In fact, I am going to be his.
  • Gwendolen. [Inquiringly.] I beg your pardon?
  • Cecily. [Rather shy and confidingly.] Dearest Gwendolen, there is no
  • Gwendolen. [Quite politely, rising.] My darling Cecily, I think there
  • Cecily. [Very politely, rising.] I am afraid you must be under some
  • Gwendolen. [Examines diary through her lorgnettte carefully.] It is
  • Cecily. It would distress me more than I can tell you, dear Gwendolen,
  • Gwendolen. [Meditatively.] If the poor fellow has been entrapped into
  • Cecily. [Thoughtfully and sadly.] Whatever unfortunate entanglement my
  • Gwendolen. Do you allude to me, Miss Cardew, as an entanglement? You
  • Cecily. Do you suggest, Miss Fairfax, that I entrapped Ernest into an
  • Gwendolen. [Satirically.] I am glad to say that I have never seen a
  • Merriman. Shall I lay tea here as usual, Miss?
  • Cecily. [Sternly, in a calm voice.] Yes, as usual. [Merriman begins to
  • Gwendolen. Are there many interesting walks in the vicinity, Miss
  • Cecily. Oh! yes! a great many. From the top of one of the hills quite
  • Gwendolen. Five counties! I don't think I should like that; I hate
  • Cecily. [Sweetly.] I suppose that is why you live in town? [Gwendolen
  • Gwendolen. [Looking round.] Quite a well-kept garden this is, Miss
  • Cardew.
  • Cecily. So glad you like it, Miss Fairfax.
  • Gwendolen. I had no idea there were any flowers in the country.
  • Cecily. Oh, flowers are as common here, Miss Fairfax, as people are in
  • London.
  • Gwendolen. Personally I cannot understand how anybody manages to exist
  • Cecily. Ah! This is what the newspapers call agricultural depression,
  • Gwendolen. [With elaborate politeness.] Thank you. [Aside.] Detestable
  • Cecily. [Sweetly.] Sugar?
  • Gwendolen. [Superciliously.] No, thank you. Sugar is not fashionable
  • Cecily. [Severely.] Cake or bread and butter?
  • Gwendolen. [In a bored manner.] Bread and butter, please. Cake is
  • Cecily. [Cuts a very large slice of cake, and puts it on the tray.] Hand
  • Gwendolen. You have filled my tea with lumps of sugar, and though I
  • Cecily. [Rising.] To save my poor, innocent, trusting boy from the
  • Gwendolen. From the moment I saw you I distrusted you. I felt that you
  • Cecily. It seems to me, Miss Fairfax, that I am trespassing on your
  • Gwendolen. [Catching sight of him.] Ernest! My own Ernest!
  • Jack. Gwendolen! Darling! [Offers to kiss her.]
  • Gwendolen. [Draws back.] A moment! May I ask if you are engaged to be
  • Jack. [Laughing.] To dear little Cecily! Of course not! What could
  • Gwendolen. Thank you. You may! [Offers her cheek.]
  • Cecily. [Very sweetly.] I knew there must be some misunderstanding,
  • Gwendolen. I beg your pardon?
  • Cecily. This is Uncle Jack.
  • Gwendolen. [Receding.] Jack! Oh!
  • Cecily. Here is Ernest.
  • Algernon. [Goes straight over to Cecily without noticing any one else.]
  • Cecily. [Drawing back.] A moment, Ernest! May I ask you--are you
  • Algernon. [Looking round.] To what young lady? Good heavens!
  • Cecily. Yes! to good heavens, Gwendolen, I mean to Gwendolen.
  • Algernon. [Laughing.] Of course not! What could have put such an idea
  • Cecily. Thank you. [Presenting her cheek to be kissed.] You may.
  • Gwendolen. I felt there was some slight error, Miss Cardew. The
  • Cecily. [Breaking away from Algernon.] Algernon Moncrieff! Oh! [The
  • Cecily. Are you called Algernon?
  • Algernon. I cannot deny it.
  • Cecily. Oh!
  • Gwendolen. Is your name really John?
  • Jack. [Standing rather proudly.] I could deny it if I liked. I could
  • Cecily. [To Gwendolen.] A gross deception has been practised on both of
  • Gwendolen. My poor wounded Cecily!
  • Cecily. My sweet wronged Gwendolen!
  • Gwendolen. [Slowly and seriously.] You will call me sister, will you
  • Cecily. [Rather brightly.] There is just one question I would like to
  • Gwendolen. An admirable idea! Mr. Worthing, there is just one question
  • Jack. [Slowly and hesitatingly.] Gwendolen--Cecily--it is very painful
  • Cecily. [Surprised.] No brother at all?
  • Jack. [Cheerily.] None!
  • Gwendolen. [Severely.] Had you never a brother of any kind?
  • Jack. [Pleasantly.] Never. Not even of any kind.
  • Gwendolen. I am afraid it is quite clear, Cecily, that neither of us is
  • Cecily. It is not a very pleasant position for a young girl suddenly to
  • Gwendolen. Let us go into the house. They will hardly venture to come
  • Cecily. No, men are so cowardly, aren't they?
  • Jack. This ghastly state of things is what you call Bunburying, I
  • Algernon. Yes, and a perfectly wonderful Bunbury it is. The most
  • Jack. Well, you've no right whatsoever to Bunbury here.
  • Algernon. That is absurd. One has a right to Bunbury anywhere one
  • Jack. Serious Bunburyist! Good heavens!
  • Algernon. Well, one must be serious about something, if one wants to
  • Jack. Well, the only small satisfaction I have in the whole of this
  • Algernon. Your brother is a little off colour, isn't he, dear Jack? You
  • Jack. As for your conduct towards Miss Cardew, I must say that your
  • Algernon. I can see no possible defence at all for your deceiving a
  • Jack. I wanted to be engaged to Gwendolen, that is all. I love her.
  • Algernon. Well, I simply wanted to be engaged to Cecily. I adore her.
  • Jack. There is certainly no chance of your marrying Miss Cardew.
  • Algernon. I don't think there is much likelihood, Jack, of you and Miss
  • Jack. Well, that is no business of yours.
  • Algernon. If it was my business, I wouldn't talk about it. [Begins to
  • Jack. How can you sit there, calmly eating muffins when we are in this
  • Algernon. Well, I can't eat muffins in an agitated manner. The butter
  • Jack. I say it's perfectly heartless your eating muffins at all, under
  • Algernon. When I am in trouble, eating is the only thing that consoles
  • Jack. [Rising.] Well, that is no reason why you should eat them all in
  • Algernon. [Offering tea-cake.] I wish you would have tea-cake instead.
  • Jack. Good heavens! I suppose a man may eat his own muffins in his own
  • Algernon. But you have just said it was perfectly heartless to eat
  • Jack. I said it was perfectly heartless of you, under the circumstances.
  • Algernon. That may be. But the muffins are the same. [He seizes the
  • Jack. Algy, I wish to goodness you would go.
  • Algernon. You can't possibly ask me to go without having some dinner.
  • Ernest.
  • Jack. My dear fellow, the sooner you give up that nonsense the better. I
  • Algernon. Yes, but I have not been christened for years.
  • Jack. Yes, but you have been christened. That is the important thing.
  • Algernon. Quite so. So I know my constitution can stand it. If you are
  • Jack. Yes, but you said yourself that a severe chill was not hereditary.
  • Algernon. It usen't to be, I know--but I daresay it is now. Science is
  • Jack. [Picking up the muffin-dish.] Oh, that is nonsense; you are
  • Algernon. Jack, you are at the muffins again! I wish you wouldn't.
  • Jack. But I hate tea-cake.
  • Algernon. Why on earth then do you allow tea-cake to be served up for
  • Jack. Algernon! I have already told you to go. I don't want you here.
  • Algernon. I haven't quite finished my tea yet! and there is still one
  • Gwendolen. The fact that they did not follow us at once into the house,
  • Cecily. They have been eating muffins. That looks like repentance.
  • Gwendolen. [After a pause.] They don't seem to notice us at all.
  • Cecily. But I haven't got a cough.
  • Gwendolen. They're looking at us. What effrontery!
  • Cecily. They're approaching. That's very forward of them.
  • Gwendolen. Let us preserve a dignified silence.
  • Cecily. Certainly. It's the only thing to do now. [Enter Jack followed
  • Opera.]
  • Gwendolen. This dignified silence seems to produce an unpleasant effect.
  • Cecily. A most distasteful one.
  • Gwendolen. But we will not be the first to speak.
  • Cecily. Certainly not.
  • Gwendolen. Mr. Worthing, I have something very particular to ask you.
  • Cecily. Gwendolen, your common sense is invaluable. Mr. Moncrieff,
  • Algernon. In order that I might have an opportunity of meeting you.
  • Cecily. [To Gwendolen.] That certainly seems a satisfactory
  • Gwendolen. Yes, dear, if you can believe him.
  • Cecily. I don't. But that does not affect the wonderful beauty of his
  • Gwendolen. True. In matters of grave importance, style, not sincerity
  • Jack. Can you doubt it, Miss Fairfax?
  • Gwendolen. I have the gravest doubts upon the subject. But I intend to
  • Cecily.] Their explanations appear to be quite satisfactory, especially
  • Mr. Worthing's. That seems to me to have the stamp of truth upon it.
  • Cecily. I am more than content with what Mr. Moncrieff said. His voice
  • Gwendolen. Then you think we should forgive them?
  • Cecily. Yes. I mean no.
  • Gwendolen. True! I had forgotten. There are principles at stake that
  • Cecily. Could we not both speak at the same time?
  • Gwendolen. An excellent idea! I nearly always speak at the same time as
  • Cecily. Certainly. [Gwendolen beats time with uplifted finger.]
  • Gwendolen. [To Jack.] For my sake you are prepared to do this terrible
  • Jack. I am.
  • Cecily. [To Algernon.] To please me you are ready to face this fearful
  • Algernon. I am!
  • Gwendolen. How absurd to talk of the equality of the sexes! Where
  • Jack. We are. [Clasps hands with Algernon.]
  • Cecily. They have moments of physical courage of which we women know
  • Gwendolen. [To Jack.] Darling!
  • Algernon. [To Cecily.] Darling! [They fall into each other's arms.]
  • Merriman. Ahem! Ahem! Lady Bracknell!
  • Jack. Good heavens!
  • Gwendolen. Merely that I am engaged to be married to Mr. Worthing,
  • Jack. I am engaged to be married to Gwendolen, Lady Bracknell!
  • Algernon. Yes, Aunt Augusta.
  • Algernon. [Stammering.] Oh! No! Bunbury doesn't live here. Bunbury
  • Algernon. [Airily.] Oh! I killed Bunbury this afternoon. I mean poor
  • Algernon. Bunbury? Oh, he was quite exploded.
  • Algernon. My dear Aunt Augusta, I mean he was found out! The doctors
  • Jack. That lady is Miss Cecily Cardew, my ward. [Lady Bracknell bows
  • Algernon. I am engaged to be married to Cecily, Aunt Augusta.
  • Cecily. Mr. Moncrieff and I are engaged to be married, Lady Bracknell.
  • Jack. [In a clear, cold voice.] Miss Cardew is the grand-daughter of
  • Jack. I have carefully preserved the Court Guides of the period. They
  • Jack. Miss Cardew's family solicitors are Messrs. Markby, Markby, and
  • Markby.
  • Jack. [Very irritably.] How extremely kind of you, Lady Bracknell! I
  • Jack. Oh! about a hundred and thirty thousand pounds in the Funds. That
  • Jack. And after six months nobody knew her.
  • Algernon. Yes, Aunt Augusta!
  • Algernon. Cecily is the sweetest, dearest, prettiest girl in the whole
  • Algernon. Thank you, Aunt Augusta.
  • Cecily. [Kisses her.] Thank you, Lady Bracknell.
  • Cecily. Thank you, Aunt Augusta.
  • Algernon. Thank you, Aunt Augusta.
  • Cecily. Thank you, Aunt Augusta.
  • Jack. I beg your pardon for interrupting you, Lady Bracknell, but this
  • Jack. It pains me very much to have to speak frankly to you, Lady
  • Oxonian.
  • Jack. I fear there can be no possible doubt about the matter. This
  • Jack. That is very generous of you, Lady Bracknell. My own decision,
  • Cecily. Well, I am really only eighteen, but I always admit to twenty
  • Jack. Pray excuse me, Lady Bracknell, for interrupting you again, but it
  • Cecily. Algy, could you wait for me till I was thirty-five?
  • Algernon. Of course I could, Cecily. You know I could.
  • Cecily. Yes, I felt it instinctively, but I couldn't wait all that time.
  • Algernon. Then what is to be done, Cecily?
  • Cecily. I don't know, Mr. Moncrieff.
  • Jack. But my dear Lady Bracknell, the matter is entirely in your own
  • Jack. Then a passionate celibacy is all that any of us can look forward
  • Chasuble. Everything is quite ready for the christenings.
  • Chasuble. [Looking rather puzzled, and pointing to Jack and Algernon.]
  • Chasuble. Am I to understand then that there are to be no christenings
  • Jack. I don't think that, as things are now, it would be of much
  • Chasuble. I am grieved to hear such sentiments from you, Mr. Worthing.
  • Chasuble. Yes, Lady Bracknell. I am on my way to join her.
  • Chasuble. [Somewhat indignantly.] She is the most cultivated of ladies,
  • Chasuble. [Severely.] I am a celibate, madam.
  • Jack. [Interposing.] Miss Prism, Lady Bracknell, has been for the last
  • Chasuble. [Looking off.] She approaches; she is nigh.
  • Jack. [Who has been listening attentively.] But where did you deposit
  • Jack. Miss Prism, this is a matter of no small importance to me. I
  • Jack. What railway station?
  • Jack. I must retire to my room for a moment. Gwendolen, wait here for
  • Gwendolen. If you are not too long, I will wait here for you all my
  • Chasuble. What do you think this means, Lady Bracknell?
  • Cecily. Uncle Jack seems strangely agitated.
  • Chasuble. Your guardian has a very emotional nature.
  • Chasuble. [Looking up.] It has stopped now. [The noise is redoubled.]
  • Gwendolen. This suspense is terrible. I hope it will last. [Enter Jack
  • Jack. [Rushing over to Miss Prism.] Is this the hand-bag, Miss Prism?
  • Jack. [In a pathetic voice.] Miss Prism, more is restored to you than
  • Jack. [Embracing her.] Yes . . . mother!
  • Jack. Unmarried! I do not deny that is a serious blow. But after all,
  • Jack. [After a pause.] Lady Bracknell, I hate to seem inquisitive, but
  • Jack. Algy's elder brother! Then I have a brother after all. I knew I
  • Algernon. Well, not till to-day, old boy, I admit. I did my best,
  • Gwendolen. [To Jack.] My own! But what own are you? What is your
  • Jack. Good heavens! . . . I had quite forgotten that point. Your
  • Gwendolen. I never change, except in my affections.
  • Cecily. What a noble nature you have, Gwendolen!
  • Jack. Then the question had better be cleared up at once. Aunt Augusta,
  • Jack. Then I was christened! That is settled. Now, what name was I
  • Jack. [Irritably.] Yes, but what was my father's Christian name?
  • Jack. Algy! Can't you recollect what our father's Christian name was?
  • Algernon. My dear boy, we were never even on speaking terms. He died
  • Jack. His name would appear in the Army Lists of the period, I suppose,
  • Jack. The Army Lists of the last forty years are here. These delightful
  • Gwendolen. Ernest! My own Ernest! I felt from the first that you could
  • Jack. Gwendolen, it is a terrible thing for a man to find out suddenly
  • Gwendolen. I can. For I feel that you are sure to change.
  • Jack. My own one!
  • Chasuble. [To Miss Prism.] Laetitia! [Embraces her]
  • Algernon. Cecily! [Embraces her.] At last!
  • Jack. Gwendolen! [Embraces her.] At last!
  • Jack. On the contrary, Aunt Augusta, I've now realised for the first
  • FIRST ACT
  • SCENE
  • Morning-room in Algernon's flat in Half-Moon Street. The room is
  • luxuriously and artistically furnished. The sound of a piano is heard in
  • the adjoining room.
  • [Lane is arranging afternoon tea on the table, and after the music has
  • ceased, Algernon enters.]
  • accurately--any one can play accurately--but I play with wonderful
  • expression. As far as the piano is concerned, sentiment is my forte. I
  • keep science for Life.
  • cucumber sandwiches cut for Lady Bracknell?
  • by the way, Lane, I see from your book that on Thursday night, when
  • Lord Shoreman and Mr. Worthing were dining with me, eight bottles of
  • champagne are entered as having been consumed.
  • invariably drink the champagne? I ask merely for information.
  • often observed that in married households the champagne is rarely of a
  • first-rate brand.
  • little experience of it myself up to the present. I have only been
  • married once. That was in consequence of a misunderstanding between
  • myself and a young person.
  • family life, Lane.
  • it myself.
  • lower orders don't set us a good example, what on earth is the use of
  • them? They seem, as a class, to have absolutely no sense of moral
  • responsibility.
  • [Enter Lane.]
  • [Enter Jack.]
  • [Lane goes out_._]
  • Eating as usual, I see, Algy!
  • take some slight refreshment at five o'clock. Where have you been since
  • last Thursday?
  • oneself. When one is in the country one amuses other people. It is
  • excessively boring.
  • sandwich.] By the way, Shropshire is your county, is it not?
  • cucumber sandwiches? Why such reckless extravagance in one so young? Who
  • is coming to tea?
  • quite approve of your being here.
  • disgraceful. It is almost as bad as the way Gwendolen flirts with you.
  • propose to her.
  • business.
  • romantic to be in love. But there is nothing romantic about a definite
  • proposal. Why, one may be accepted. One usually is, I believe. Then
  • the excitement is all over. The very essence of romance is uncertainty.
  • If ever I get married, I'll certainly try to forget the fact.
  • specially invented for people whose memories are so curiously
  • constituted.
  • made in Heaven--[Jack puts out his hand to take a sandwich. Algernon at
  • once interferes.] Please don't touch the cucumber sandwiches. They are
  • ordered specially for Aunt Augusta. [Takes one and eats it.]
  • plate from below.] Have some bread and butter. The bread and butter is
  • for Gwendolen. Gwendolen is devoted to bread and butter.
  • butter it is too.
  • eat it all. You behave as if you were married to her already. You are
  • not married to her already, and I don't think you ever will be.
  • with. Girls don't think it right.
  • extraordinary number of bachelors that one sees all over the place. In
  • the second place, I don't give my consent.
  • allow you to marry her, you will have to clear up the whole question of
  • Cecily! I don't know any one of the name of Cecily.
  • [Enter Lane.]
  • room the last time he dined here.
  • wish to goodness you had let me know. I have been writing frantic
  • letters to Scotland Yard about it. I was very nearly offering a large
  • reward.
  • usually hard up.
  • found.
  • [Enter Lane with the cigarette case on a salver. Algernon takes it at
  • once. Lane goes out.]
  • case and examines it.] However, it makes no matter, for, now that I look
  • at the inscription inside, I find that the thing isn't yours after all.
  • hundred times, and you have no right whatsoever to read what is written
  • inside. It is a very ungentlemanly thing to read a private cigarette
  • case.
  • should read and what one shouldn't. More than half of modern culture
  • depends on what one shouldn't read.
  • modern culture. It isn't the sort of thing one should talk of in
  • private. I simply want my cigarette case back.
  • is a present from some one of the name of Cecily, and you said you didn't
  • know any one of that name.
  • Just give it back to me, Algy.
  • little Cecily if she is your aunt and lives at Tunbridge Wells?
  • [Reading.] 'From little Cecily with her fondest love.'
  • earth is there in that? Some aunts are tall, some aunts are not tall.
  • That is a matter that surely an aunt may be allowed to decide for
  • herself. You seem to think that every aunt should be exactly like your
  • aunt! That is absurd! For Heaven's sake give me back my cigarette case.
  • [Follows Algernon round the room.]
  • Cecily, with her fondest love to her dear Uncle Jack.' There is no
  • objection, I admit, to an aunt being a small aunt, but why an aunt, no
  • matter what her size may be, should call her own nephew her uncle, I
  • can't quite make out. Besides, your name isn't Jack at all; it is
  • to every one as Ernest. You answer to the name of Ernest. You look as
  • if your name was Ernest. You are the most earnest-looking person I ever
  • saw in my life. It is perfectly absurd your saying that your name isn't
  • case.] 'Mr. Ernest Worthing, B. 4, The Albany.' I'll keep this as a
  • proof that your name is Ernest if ever you attempt to deny it to me, or
  • to Gwendolen, or to any one else. [Puts the card in his pocket.]
  • cigarette case was given to me in the country.
  • Aunt Cecily, who lives at Tunbridge Wells, calls you her dear uncle.
  • Come, old boy, you had much better have the thing out at once.
  • very vulgar to talk like a dentist when one isn't a dentist. It produces
  • a false impression.
  • Tell me the whole thing. I may mention that I have always suspected you
  • of being a confirmed and secret Bunburyist; and I am quite sure of it
  • now.
  • as soon as you are kind enough to inform me why you are Ernest in town
  • and Jack in the country.
  • explanation, and pray make it improbable. [Sits on sofa.]
  • at all. In fact it's perfectly ordinary. Old Mr. Thomas Cardew, who
  • adopted me when I was a little boy, made me in his will guardian to his
  • grand-daughter, Miss Cecily Cardew. Cecily, who addresses me as her
  • uncle from motives of respect that you could not possibly appreciate,
  • lives at my place in the country under the charge of her admirable
  • governess, Miss Prism.
  • . . . I may tell you candidly that the place is not in Shropshire.
  • Shropshire on two separate occasions. Now, go on. Why are you Ernest in
  • town and Jack in the country?
  • my real motives. You are hardly serious enough. When one is placed in
  • the position of guardian, one has to adopt a very high moral tone on all
  • subjects. It's one's duty to do so. And as a high moral tone can hardly
  • be said to conduce very much to either one's health or one's happiness,
  • in order to get up to town I have always pretended to have a younger
  • brother of the name of Ernest, who lives in the Albany, and gets into the
  • most dreadful scrapes. That, my dear Algy, is the whole truth pure and
  • simple.
  • be very tedious if it were either, and modern literature a complete
  • impossibility!
  • try it. You should leave that to people who haven't been at a
  • is a Bunburyist. I was quite right in saying you were a Bunburyist. You
  • are one of the most advanced Bunburyists I know.
  • in order that you may be able to come up to town as often as you like. I
  • have invented an invaluable permanent invalid called Bunbury, in order
  • that I may be able to go down into the country whenever I choose. Bunbury
  • is perfectly invaluable. If it wasn't for Bunbury's extraordinary bad
  • health, for instance, I wouldn't be able to dine with you at Willis's to-
  • night, for I have been really engaged to Aunt Augusta for more than a
  • week.
  • invitations. It is very foolish of you. Nothing annoys people so much
  • as not receiving invitations.
  • kind. To begin with, I dined there on Monday, and once a week is quite
  • enough to dine with one's own relations. In the second place, whenever I
  • do dine there I am always treated as a member of the family, and sent
  • down with either no woman at all, or two. In the third place, I know
  • perfectly well whom she will place me next to, to-night. She will place
  • me next Mary Farquhar, who always flirts with her own husband across the
  • dinner-table. That is not very pleasant. Indeed, it is not even decent
  • . . . and that sort of thing is enormously on the increase. The amount
  • of women in London who flirt with their own husbands is perfectly
  • scandalous. It looks so bad. It is simply washing one's clean linen in
  • public. Besides, now that I know you to be a confirmed Bunburyist I
  • naturally want to talk to you about Bunburying. I want to tell you the
  • rules.
  • to kill my brother, indeed I think I'll kill him in any case. Cecily is
  • a little too much interested in him. It is rather a bore. So I am going
  • to get rid of Ernest. And I strongly advise you to do the same with Mr.
  • . . . with your invalid friend who has the absurd name.
  • get married, which seems to me extremely problematic, you will be very
  • glad to know Bunbury. A man who marries without knowing Bunbury has a
  • very tedious time of it.
  • she is the only girl I ever saw in my life that I would marry, I
  • certainly won't want to know Bunbury.
  • married life three is company and two is none.
  • the corrupt French Drama has been propounding for the last fifty years.
  • time.
  • to be cynical.
  • such a lot of beastly competition about. [The sound of an electric bell
  • is heard.] Ah! that must be Aunt Augusta. Only relatives, or creditors,
  • ever ring in that Wagnerian manner. Now, if I get her out of the way for
  • ten minutes, so that you can have an opportunity for proposing to
  • Gwendolen, may I dine with you to-night at Willis's?
  • not serious about meals. It is so shallow of them.
  • [Enter Lane.]
  • [Algernon goes forward to meet them. Enter Lady Bracknell and
  • Lady Bracknell. Good afternoon, dear Algernon, I hope you are behaving
  • very well.
  • Lady Bracknell. That's not quite the same thing. In fact the two things
  • rarely go together. [Sees Jack and bows to him with icy coldness.]
  • developments, and I intend to develop in many directions. [Gwendolen and
  • Jack sit down together in the corner.]
  • Lady Bracknell. I'm sorry if we are a little late, Algernon, but I was
  • obliged to call on dear Lady Harbury. I hadn't been there since her poor
  • husband's death. I never saw a woman so altered; she looks quite twenty
  • years younger. And now I'll have a cup of tea, and one of those nice
  • cucumber sandwiches you promised me.
  • Lady Bracknell. Won't you come and sit here, Gwendolen?
  • are there no cucumber sandwiches? I ordered them specially.
  • sir. I went down twice.
  • cucumbers, not even for ready money.
  • Lady Bracknell. It really makes no matter, Algernon. I had some
  • crumpets with Lady Harbury, who seems to me to be living entirely for
  • pleasure now.
  • Lady Bracknell. It certainly has changed its colour. From what cause I,
  • of course, cannot say. [Algernon crosses and hands tea.] Thank you.
  • I've quite a treat for you to-night, Algernon. I am going to send you
  • down with Mary Farquhar. She is such a nice woman, and so attentive to
  • her husband. It's delightful to watch them.
  • pleasure of dining with you to-night after all.
  • Lady Bracknell. [Frowning.] I hope not, Algernon. It would put my
  • table completely out. Your uncle would have to dine upstairs.
  • Fortunately he is accustomed to that.
  • disappointment to me, but the fact is I have just had a telegram to say
  • that my poor friend Bunbury is very ill again. [Exchanges glances with
  • Lady Bracknell. It is very strange. This Mr. Bunbury seems to suffer
  • from curiously bad health.
  • Lady Bracknell. Well, I must say, Algernon, that I think it is high time
  • that Mr. Bunbury made up his mind whether he was going to live or to die.
  • This shilly-shallying with the question is absurd. Nor do I in any way
  • approve of the modern sympathy with invalids. I consider it morbid.
  • Illness of any kind is hardly a thing to be encouraged in others. Health
  • is the primary duty of life. I am always telling that to your poor
  • uncle, but he never seems to take much notice . . . as far as any
  • improvement in his ailment goes. I should be much obliged if you would
  • ask Mr. Bunbury, from me, to be kind enough not to have a relapse on
  • Saturday, for I rely on you to arrange my music for me. It is my last
  • reception, and one wants something that will encourage conversation,
  • particularly at the end of the season when every one has practically said
  • whatever they had to say, which, in most cases, was probably not much.
  • and I think I can promise you he'll be all right by Saturday. Of course
  • the music is a great difficulty. You see, if one plays good music,
  • people don't listen, and if one plays bad music people don't talk. But
  • I'll run over the programme I've drawn out, if you will kindly come into
  • the next room for a moment.
  • Lady Bracknell. Thank you, Algernon. It is very thoughtful of you.
  • [Rising, and following Algernon.] I'm sure the programme will be
  • delightful, after a few expurgations. French songs I cannot possibly
  • allow. People always seem to think that they are improper, and either
  • look shocked, which is vulgar, or laugh, which is worse. But German
  • sounds a thoroughly respectable language, and indeed, I believe is so.
  • Gwendolen, you will accompany me.
  • [Lady Bracknell and Algernon go into the music-room, Gwendolen remains
  • behind.]
  • Whenever people talk to me about the weather, I always feel quite certain
  • that they mean something else. And that makes me so nervous.
  • Bracknell's temporary absence . . .
  • coming back suddenly into a room that I have often had to speak to her
  • about.
  • you more than any girl . . . I have ever met since . . . I met you.
  • that in public, at any rate, you had been more demonstrative. For me you
  • have always had an irresistible fascination. Even before I met you I was
  • far from indifferent to you. [Jack looks at her in amazement.] We live,
  • as I hope you know, Mr. Worthing, in an age of ideals. The fact is
  • constantly mentioned in the more expensive monthly magazines, and has
  • reached the provincial pulpits, I am told; and my ideal has always been
  • to love some one of the name of Ernest. There is something in that name
  • that inspires absolute confidence. The moment Algernon first mentioned
  • to me that he had a friend called Ernest, I knew I was destined to love
  • you.
  • name wasn't Ernest?
  • mean to say you couldn't love me then?
  • and like most metaphysical speculations has very little reference at all
  • to the actual facts of real life, as we know them.
  • about the name of Ernest . . . I don't think the name suits me at all.
  • of its own. It produces vibrations.
  • other much nicer names. I think Jack, for instance, a charming name.
  • if any at all, indeed. It does not thrill. It produces absolutely no
  • vibrations . . . I have known several Jacks, and they all, without
  • exception, were more than usually plain. Besides, Jack is a notorious
  • domesticity for John! And I pity any woman who is married to a man
  • called John. She would probably never be allowed to know the entrancing
  • pleasure of a single moment's solitude. The only really safe name is
  • married at once. There is no time to be lost.
  • you led me to believe, Miss Fairfax, that you were not absolutely
  • indifferent to me.
  • has been said at all about marriage. The subject has not even been
  • touched on.
  • you any possible disappointment, Mr. Worthing, I think it only fair to
  • tell you quite frankly before-hand that I am fully determined to accept
  • you.
  • I am afraid you have had very little experience in how to propose.
  • Gerald does. All my girl-friends tell me so. What wonderfully blue eyes
  • you have, Ernest! They are quite, quite, blue. I hope you will always
  • look at me just like that, especially when there are other people
  • present. [Enter Lady Bracknell.]
  • Lady Bracknell. Mr. Worthing! Rise, sir, from this semi-recumbent
  • posture. It is most indecorous.
  • you to retire. This is no place for you. Besides, Mr. Worthing has not
  • quite finished yet.
  • Lady Bracknell. Finished what, may I ask?
  • Lady Bracknell. Pardon me, you are not engaged to any one. When you do
  • become engaged to some one, I, or your father, should his health permit
  • him, will inform you of the fact. An engagement should come on a young
  • girl as a surprise, pleasant or unpleasant, as the case may be. It is
  • hardly a matter that she could be allowed to arrange for herself . . .
  • And now I have a few questions to put to you, Mr. Worthing. While I am
  • making these inquiries, you, Gwendolen, will wait for me below in the
  • carriage.
  • Lady Bracknell. In the carriage, Gwendolen! [Gwendolen goes to the
  • door. She and Jack blow kisses to each other behind Lady Bracknell's
  • back. Lady Bracknell looks vaguely about as if she could not understand
  • what the noise was. Finally turns round.] Gwendolen, the carriage!
  • Lady Bracknell. [Sitting down.] You can take a seat, Mr. Worthing.
  • [Looks in her pocket for note-book and pencil.]
  • Lady Bracknell. [Pencil and note-book in hand.] I feel bound to tell
  • you that you are not down on my list of eligible young men, although I
  • have the same list as the dear Duchess of Bolton has. We work together,
  • in fact. However, I am quite ready to enter your name, should your
  • answers be what a really affectionate mother requires. Do you smoke?
  • Lady Bracknell. I am glad to hear it. A man should always have an
  • occupation of some kind. There are far too many idle men in London as it
  • is. How old are you?
  • Lady Bracknell. A very good age to be married at. I have always been of
  • opinion that a man who desires to get married should know either
  • everything or nothing. Which do you know?
  • Lady Bracknell. I am pleased to hear it. I do not approve of anything
  • that tampers with natural ignorance. Ignorance is like a delicate exotic
  • fruit; touch it and the bloom is gone. The whole theory of modern
  • education is radically unsound. Fortunately in England, at any rate,
  • education produces no effect whatsoever. If it did, it would prove a
  • serious danger to the upper classes, and probably lead to acts of
  • violence in Grosvenor Square. What is your income?
  • Lady Bracknell. [Makes a note in her book.] In land, or in investments?
  • Lady Bracknell. That is satisfactory. What between the duties expected
  • of one during one's lifetime, and the duties exacted from one after one's
  • death, land has ceased to be either a profit or a pleasure. It gives one
  • position, and prevents one from keeping it up. That's all that can be
  • said about land.
  • about fifteen hundred acres, I believe; but I don't depend on that for my
  • real income. In fact, as far as I can make out, the poachers are the
  • only people who make anything out of it.
  • Lady Bracknell. A country house! How many bedrooms? Well, that point
  • can be cleared up afterwards. You have a town house, I hope? A girl
  • with a simple, unspoiled nature, like Gwendolen, could hardly be expected
  • to reside in the country.
  • to Lady Bloxham. Of course, I can get it back whenever I like, at six
  • months' notice.
  • Lady Bracknell. Lady Bloxham? I don't know her.
  • advanced in years.
  • Lady Bracknell. Ah, nowadays that is no guarantee of respectability of
  • character. What number in Belgrave Square?
  • Lady Bracknell. [Shaking her head.] The unfashionable side. I thought
  • there was something. However, that could easily be altered.
  • Lady Bracknell. [Sternly.] Both, if necessary, I presume. What are
  • your politics?
  • Lady Bracknell. Oh, they count as Tories. They dine with us. Or come
  • in the evening, at any rate. Now to minor matters. Are your parents
  • living?
  • Lady Bracknell. To lose one parent, Mr. Worthing, may be regarded as a
  • misfortune; to lose both looks like carelessness. Who was your father?
  • He was evidently a man of some wealth. Was he born in what the Radical
  • papers call the purple of commerce, or did he rise from the ranks of the
  • aristocracy?
  • said I had lost my parents. It would be nearer the truth to say that my
  • parents seem to have lost me . . . I don't actually know who I am by
  • birth. I was . . . well, I was found.
  • Lady Bracknell. Found!
  • and kindly disposition, found me, and gave me the name of Worthing,
  • because he happened to have a first-class ticket for Worthing in his
  • pocket at the time. Worthing is a place in Sussex. It is a seaside
  • resort.
  • Lady Bracknell. Where did the charitable gentleman who had a first-class
  • ticket for this seaside resort find you?
  • Lady Bracknell. A hand-bag?
  • somewhat large, black leather hand-bag, with handles to it--an ordinary
  • hand-bag in fact.
  • Lady Bracknell. In what locality did this Mr. James, or Thomas, Cardew
  • come across this ordinary hand-bag?
  • mistake for his own.
  • Lady Bracknell. The cloak-room at Victoria Station?
  • Lady Bracknell. The line is immaterial. Mr. Worthing, I confess I feel
  • somewhat bewildered by what you have just told me. To be born, or at any
  • rate bred, in a hand-bag, whether it had handles or not, seems to me to
  • display a contempt for the ordinary decencies of family life that reminds
  • one of the worst excesses of the French Revolution. And I presume you
  • know what that unfortunate movement led to? As for the particular
  • locality in which the hand-bag was found, a cloak-room at a railway
  • station might serve to conceal a social indiscretion--has probably,
  • indeed, been used for that purpose before now--but it could hardly be
  • regarded as an assured basis for a recognised position in good society.
  • say I would do anything in the world to ensure Gwendolen's happiness.
  • Lady Bracknell. I would strongly advise you, Mr. Worthing, to try and
  • acquire some relations as soon as possible, and to make a definite effort
  • to produce at any rate one parent, of either sex, before the season is
  • quite over.
  • produce the hand-bag at any moment. It is in my dressing-room at home. I
  • really think that should satisfy you, Lady Bracknell.
  • Lady Bracknell. Me, sir! What has it to do with me? You can hardly
  • imagine that I and Lord Bracknell would dream of allowing our only
  • daughter--a girl brought up with the utmost care--to marry into a cloak-
  • room, and form an alliance with a parcel? Good morning, Mr. Worthing!
  • [Lady Bracknell sweeps out in majestic indignation.]
  • Wedding March. Jack looks perfectly furious, and goes to the door.] For
  • goodness' sake don't play that ghastly tune, Algy. How idiotic you are!
  • [The music stops and Algernon enters cheerily.]
  • Gwendolen refused you? I know it is a way she has. She is always
  • refusing people. I think it is most ill-natured of her.
  • concerned, we are engaged. Her mother is perfectly unbearable. Never
  • met such a Gorgon . . . I don't really know what a Gorgon is like, but I
  • am quite sure that Lady Bracknell is one. In any case, she is a monster,
  • without being a myth, which is rather unfair . . . I beg your pardon,
  • Algy, I suppose I shouldn't talk about your own aunt in that way before
  • you.
  • only thing that makes me put up with them at all. Relations are simply a
  • tedious pack of people, who haven't got the remotest knowledge of how to
  • live, nor the smallest instinct about when to die.
  • about things.
  • You don't think there is any chance of Gwendolen becoming like her mother
  • in about a hundred and fifty years, do you, Algy?
  • No man does. That's his.
  • in civilised life should be.
  • You can't go anywhere without meeting clever people. The thing has
  • become an absolute public nuisance. I wish to goodness we had a few
  • fools left.
  • Ernest in town, and Jack in the country?
  • quite the sort of thing one tells to a nice, sweet, refined girl. What
  • extraordinary ideas you have about the way to behave to a woman!
  • she is pretty, and to some one else, if she is plain.
  • say he died in Paris of apoplexy. Lots of people die of apoplexy, quite
  • suddenly, don't they?
  • thing that runs in families. You had much better say a severe chill.
  • kind?
  • in Paris, by a severe chill. That gets rid of him.
  • much interested in your poor brother Ernest? Won't she feel his loss a
  • good deal?
  • glad to say. She has got a capital appetite, goes long walks, and pays
  • no attention at all to her lessons.
  • pretty, and she is only just eighteen.
  • pretty ward who is only just eighteen?
  • Gwendolen are perfectly certain to be extremely great friends. I'll bet
  • you anything you like that half an hour after they have met, they will be
  • calling each other sister.
  • other things first. Now, my dear boy, if we want to get a good table at
  • Willis's, we really must go and dress. Do you know it is nearly seven?
  • hard work where there is no definite object of any kind.
  • [Enter Lane.]
  • [Enter Gwendolen. Lane goes out.]
  • particular to say to Mr. Worthing.
  • life. You are not quite old enough to do that. [Algernon retires to the
  • fireplace.]
  • mamma's face I fear we never shall. Few parents nowadays pay any regard
  • to what their children say to them. The old-fashioned respect for the
  • young is fast dying out. Whatever influence I ever had over mamma, I
  • lost at the age of three. But although she may prevent us from becoming
  • man and wife, and I may marry some one else, and marry often, nothing
  • that she can possibly do can alter my eternal devotion to you.
  • with unpleasing comments, has naturally stirred the deeper fibres of my
  • nature. Your Christian name has an irresistible fascination. The
  • simplicity of your character makes you exquisitely incomprehensible to
  • me. Your town address at the Albany I have. What is your address in the
  • country?
  • [Algernon, who has been carefully listening, smiles to himself, and
  • writes the address on his shirt-cuff. Then picks up the Railway Guide.]
  • necessary to do something desperate. That of course will require serious
  • consideration. I will communicate with you daily.
  • [Lane presents several letters on a salver to Algernon. It is to be
  • surmised that they are bills, as Algernon, after looking at the
  • envelopes, tears them up.]
  • dress clothes, my smoking jacket, and all the Bunbury suits . . .
  • [Enter Jack. Lane goes off.]
  • for in my life. [Algernon is laughing immoderately.] What on earth are
  • you so amused at?
  • serious scrape some day.
  • serious.
  • [Jack looks indignantly at him, and leaves the room. Algernon lights a
  • cigarette, reads his shirt-cuff, and smiles.]
  • ACT DROP
  • SECOND ACT
  • SCENE
  • Garden at the Manor House. A flight of grey stone steps leads up to the
  • house. The garden, an old-fashioned one, full of roses. Time of year,
  • large yew-tree.
  • [Miss Prism discovered seated at the table. Cecily is at the back
  • watering flowers.]
  • Miss Prism. [Calling.] Cecily, Cecily! Surely such a utilitarian
  • occupation as the watering of flowers is rather Moulton's duty than
  • yours? Especially at a moment when intellectual pleasures await you.
  • Your German grammar is on the table. Pray open it at page fifteen. We
  • will repeat yesterday's lesson.
  • at all a becoming language. I know perfectly well that I look quite
  • plain after my German lesson.
  • Miss Prism. Child, you know how anxious your guardian is that you should
  • improve yourself in every way. He laid particular stress on your German,
  • as he was leaving for town yesterday. Indeed, he always lays stress on
  • your German when he is leaving for town.
  • that I think he cannot be quite well.
  • Miss Prism. [Drawing herself up.] Your guardian enjoys the best of
  • health, and his gravity of demeanour is especially to be commended in one
  • so comparatively young as he is. I know no one who has a higher sense of
  • duty and responsibility.
  • three are together.
  • Miss Prism. Cecily! I am surprised at you. Mr. Worthing has many
  • troubles in his life. Idle merriment and triviality would be out of
  • place in his conversation. You must remember his constant anxiety about
  • that unfortunate young man his brother.
  • brother, to come down here sometimes. We might have a good influence
  • over him, Miss Prism. I am sure you certainly would. You know German,
  • and geology, and things of that kind influence a man very much. [Cecily
  • begins to write in her diary.]
  • Miss Prism. [Shaking her head.] I do not think that even I could
  • produce any effect on a character that according to his own brother's
  • admission is irretrievably weak and vacillating. Indeed I am not sure
  • that I would desire to reclaim him. I am not in favour of this modern
  • mania for turning bad people into good people at a moment's notice. As a
  • man sows so let him reap. You must put away your diary, Cecily. I
  • really don't see why you should keep a diary at all.
  • life. If I didn't write them down, I should probably forget all about
  • them.
  • Miss Prism. Memory, my dear Cecily, is the diary that we all carry about
  • with us.
  • happened, and couldn't possibly have happened. I believe that Memory is
  • responsible for nearly all the three-volume novels that Mudie sends us.
  • Miss Prism. Do not speak slightingly of the three-volume novel, Cecily.
  • I wrote one myself in earlier days.
  • hope it did not end happily? I don't like novels that end happily. They
  • depress me so much.
  • Miss Prism. The good ended happily, and the bad unhappily. That is what
  • Fiction means.
  • ever published?
  • Miss Prism. Alas! no. The manuscript unfortunately was abandoned.
  • [Cecily starts.] I use the word in the sense of lost or mislaid. To
  • your work, child, these speculations are profitless.
  • garden.
  • Miss Prism. [Rising and advancing.] Dr. Chasuble! This is indeed a
  • pleasure.
  • [Enter Canon Chasuble.]
  • well?
  • think it would do her so much good to have a short stroll with you in the
  • Park, Dr. Chasuble.
  • Miss Prism. Cecily, I have not mentioned anything about a headache.
  • you had a headache. Indeed I was thinking about that, and not about my
  • German lesson, when the Rector came in.
  • pupil, I would hang upon her lips. [Miss Prism glares.] I spoke
  • metaphorically.--My metaphor was drawn from bees. Ahem! Mr. Worthing, I
  • suppose, has not returned from town yet?
  • Miss Prism. We do not expect him till Monday afternoon.
  • not one of those whose sole aim is enjoyment, as, by all accounts, that
  • unfortunate young man his brother seems to be. But I must not disturb
  • Egeria and her pupil any longer.
  • Miss Prism. Egeria? My name is Laetitia, Doctor.
  • authors. I shall see you both no doubt at Evensong?
  • Miss Prism. I think, dear Doctor, I will have a stroll with you. I find
  • I have a headache after all, and a walk might do it good.
  • as the schools and back.
  • Miss Prism. That would be delightful. Cecily, you will read your
  • Political Economy in my absence. The chapter on the Fall of the Rupee
  • you may omit. It is somewhat too sensational. Even these metallic
  • problems have their melodramatic side.
  • [Goes down the garden with Dr. Chasuble.]
  • Political Economy! Horrid Geography! Horrid, horrid German!
  • [Enter Merriman with a card on a salver.]
  • has brought his luggage with him.
  • Albany, W.' Uncle Jack's brother! Did you tell him Mr. Worthing was in
  • town?
  • that you and Miss Prism were in the garden. He said he was anxious to
  • speak to you privately for a moment.
  • talk to the housekeeper about a room for him.
  • [Merriman goes off.]
  • frightened. I am so afraid he will look just like every one else.
  • [Enter Algernon, very gay and debonnair.] He does!
  • I believe I am more than usually tall for my age. [Algernon is rather
  • taken aback.] But I am your cousin Cecily. You, I see from your card,
  • are Uncle Jack's brother, my cousin Ernest, my wicked cousin Ernest.
  • think that I am wicked.
  • a very inexcusable manner. I hope you have not been leading a double
  • life, pretending to be wicked and being really good all the time. That
  • would be hypocrisy.
  • rather reckless.
  • my own small way.
  • it must have been very pleasant.
  • back till Monday afternoon.
  • first train on Monday morning. I have a business appointment that I am
  • anxious . . . to miss?
  • business engagement, if one wants to retain any sense of the beauty of
  • life, but still I think you had better wait till Uncle Jack arrives. I
  • know he wants to speak to you about your emigrating.
  • in neckties at all.
  • you to Australia.
  • to choose between this world, the next world, and Australia.
  • next world, are not particularly encouraging. This world is good enough
  • for me, cousin Cecily.
  • You might make that your mission, if you don't mind, cousin Cecily.
  • is going to lead an entirely new life, one requires regular and wholesome
  • meals. Won't you come in?
  • appetite unless I have a buttonhole first.
  • Miss Prism never says such things to me.
  • rose in his buttonhole.] You are the prettiest girl I ever saw.
  • caught in.
  • shouldn't know what to talk to him about.
  • [They pass into the house. Miss Prism and Dr. Chasuble return.]
  • Miss Prism. You are too much alone, dear Dr. Chasuble. You should get
  • married. A misanthrope I can understand--a womanthrope, never!
  • neologistic a phrase. The precept as well as the practice of the
  • Primitive Church was distinctly against matrimony.
  • Miss Prism. [Sententiously.] That is obviously the reason why the
  • Primitive Church has not lasted up to the present day. And you do not
  • seem to realise, dear Doctor, that by persistently remaining single, a
  • man converts himself into a permanent public temptation. Men should be
  • more careful; this very celibacy leads weaker vessels astray.
  • Miss Prism. No married man is ever attractive except to his wife.
  • Miss Prism. That depends on the intellectual sympathies of the woman.
  • Maturity can always be depended on. Ripeness can be trusted. Young
  • women are green. [Dr. Chasuble starts.] I spoke horticulturally. My
  • metaphor was drawn from fruits. But where is Cecily?
  • [Enter Jack slowly from the back of the garden. He is dressed in the
  • deepest mourning, with crape hatband and black gloves.]
  • Miss Prism. Mr. Worthing!
  • Miss Prism. This is indeed a surprise. We did not look for you till
  • Monday afternoon.
  • sooner than I expected. Dr. Chasuble, I hope you are well?
  • some terrible calamity?
  • Miss Prism. More shameful debts and extravagance?
  • Miss Prism. What a lesson for him! I trust he will profit by it.
  • least the consolation of knowing that you were always the most generous
  • and forgiving of brothers.
  • night from the manager of the Grand Hotel.
  • Miss Prism. As a man sows, so shall he reap.
  • of us are perfect. I myself am peculiarly susceptible to draughts. Will
  • the interment take place here?
  • any very serious state of mind at the last. You would no doubt wish me
  • to make some slight allusion to this tragic domestic affliction next
  • of the manna in the wilderness can be adapted to almost any occasion,
  • joyful, or, as in the present case, distressing. [All sigh.] I have
  • preached it at harvest celebrations, christenings, confirmations, on days
  • of humiliation and festal days. The last time I delivered it was in the
  • Cathedral, as a charity sermon on behalf of the Society for the
  • Prevention of Discontent among the Upper Orders. The Bishop, who was
  • present, was much struck by some of the analogies I drew.
  • Chasuble? I suppose you know how to christen all right? [Dr. Chasuble
  • looks astounded.] I mean, of course, you are continually christening,
  • aren't you?
  • Miss Prism. It is, I regret to say, one of the Rector's most constant
  • duties in this parish. I have often spoken to the poorer classes on the
  • subject. But they don't seem to know what thrift is.
  • Miss Prism. [Bitterly.] People who live entirely for pleasure usually
  • are.
  • children. No! the fact is, I would like to be christened myself, this
  • afternoon, if you have nothing better to do.
  • would bother you in any way, or if you think I am a little too old now.
  • adults is a perfectly canonical practice.
  • necessary, or indeed I think advisable. Our weather is so changeable. At
  • what hour would you wish the ceremony performed?
  • to perform at that time. A case of twins that occurred recently in one
  • of the outlying cottages on your own estate. Poor Jenkins the carter, a
  • most hard-working man.
  • babies. It would be childish. Would half-past five do?
  • Worthing, I will not intrude any longer into a house of sorrow. I would
  • merely beg you not to be too much bowed down by grief. What seem to us
  • bitter trials are often blessings in disguise.
  • Miss Prism. This seems to me a blessing of an extremely obvious kind.
  • [Enter Cecily from the house.]
  • clothes you have got on! Do go and change them.
  • Miss Prism. Cecily!
  • brow in a melancholy manner.]
  • you had toothache, and I have got such a surprise for you. Who do you
  • think is in the dining-room? Your brother!
  • the past he is still your brother. You couldn't be so heartless as to
  • disown him. I'll tell him to come out. And you will shake hands with
  • him, won't you, Uncle Jack? [Runs back into the house.]
  • Miss Prism. After we had all been resigned to his loss, his sudden
  • return seems to me peculiarly distressing.
  • I think it is perfectly absurd.
  • [Enter Algernon and Cecily hand in hand. They come slowly up to Jack.]
  • very sorry for all the trouble I have given you, and that I intend to
  • lead a better life in the future. [Jack glares at him and does not take
  • his hand.]
  • here disgraceful. He knows perfectly well why.
  • has just been telling me about his poor invalid friend Mr. Bunbury whom
  • he goes to visit so often. And surely there must be much good in one who
  • is kind to an invalid, and leaves the pleasures of London to sit by a bed
  • of pain.
  • state of health.
  • about anything else. It is enough to drive one perfectly frantic.
  • must say that I think that Brother John's coldness to me is peculiarly
  • painful. I expected a more enthusiastic welcome, especially considering
  • it is the first time I have come here.
  • forgive you.
  • Algernon and glares.]
  • I think we might leave the two brothers together.
  • Miss Prism. Cecily, you will come with us.
  • over.
  • Miss Prism. We must not be premature in our judgments.
  • as possible. I don't allow any Bunburying here.
  • [Enter Merriman.]
  • I suppose that is all right?
  • the room next to your own.
  • and a large luncheon-basket.
  • suddenly called back to town.
  • back to town at all.
  • in the smallest degree.
  • ridiculous in them. Why on earth don't you go up and change? It is
  • perfectly childish to be in deep mourning for a man who is actually
  • staying for a whole week with you in your house as a guest. I call it
  • grotesque.
  • or anything else. You have got to leave . . . by the four-five train.
  • would be most unfriendly. If I were in mourning you would stay with me,
  • I suppose. I should think it very unkind if you didn't.
  • long to dress, and with such little result.
  • as you are.
  • by being always immensely over-educated.
  • presence in my garden utterly absurd. However, you have got to catch the
  • four-five, and I hope you will have a pleasant journey back to town. This
  • Bunburying, as you call it, has not been a great success for you.
  • [Goes into the house.]
  • and that is everything.
  • [Enter Cecily at the back of the garden. She picks up the can and begins
  • to water the flowers.] But I must see her before I go, and make
  • arrangements for another Bunbury. Ah, there she is.
  • with Uncle Jack.
  • a very brief space of time. The absence of old friends one can endure
  • with equanimity. But even a momentary separation from anyone to whom one
  • has just been introduced is almost unbearable.
  • [Enter Merriman.]
  • at Cecily.]
  • frankly and openly that you seem to me to be in every way the visible
  • personification of absolute perfection.
  • will allow me, I will copy your remarks into my diary. [Goes over to
  • table and begins writing in diary.]
  • May I?
  • young girl's record of her own thoughts and impressions, and consequently
  • meant for publication. When it appears in volume form I hope you will
  • order a copy. But pray, Ernest, don't stop. I delight in taking down
  • from dictation. I have reached 'absolute perfection'. You can go on. I
  • am quite ready for more.
  • fluently and not cough. Besides, I don't know how to spell a cough.
  • [Writes as Algernon speaks.]
  • upon your wonderful and incomparable beauty, I have dared to love you
  • wildly, passionately, devotedly, hopelessly.
  • passionately, devotedly, hopelessly. Hopelessly doesn't seem to make
  • much sense, does it?
  • [Enter Merriman.]
  • [Merriman retires.]
  • staying on till next week, at the same hour.
  • whole world but you. I love you, Cecily. You will marry me, won't you?
  • last three months.
  • had a younger brother who was very wicked and bad, you of course have
  • formed the chief topic of conversation between myself and Miss Prism. And
  • of course a man who is much talked about is always very attractive. One
  • feels there must be something in him, after all. I daresay it was
  • foolish of me, but I fell in love with you, Ernest.
  • of my existence, I determined to end the matter one way or the other, and
  • after a long struggle with myself I accepted you under this dear old tree
  • here. The next day I bought this little ring in your name, and this is
  • the little bangle with the true lover's knot I promised you always to
  • wear.
  • I've always given for your leading such a bad life. And this is the box
  • in which I keep all your dear letters. [Kneels at table, opens box, and
  • produces letters tied up with blue ribbon.]
  • you any letters.
  • well that I was forced to write your letters for you. I wrote always
  • three times a week, and sometimes oftener.
  • [Replaces box.] The three you wrote me after I had broken off the
  • engagement are so beautiful, and so badly spelled, that even now I can
  • hardly read them without crying a little.
  • entry if you like. [Shows diary.] 'To-day I broke off my engagement with
  • charming.'
  • had done nothing at all. Cecily, I am very much hurt indeed to hear you
  • broke it off. Particularly when the weather was so charming.
  • hadn't been broken off at least once. But I forgave you before the week
  • was out.
  • are, Cecily.
  • through his hair.] I hope your hair curls naturally, does it?
  • you. Besides, of course, there is the question of your name.
  • girlish dream of mine to love some one whose name was Ernest. [Algernon
  • rises, Cecily also.] There is something in that name that seems to
  • inspire absolute confidence. I pity any poor married woman whose husband
  • is not called Ernest.
  • if I had some other name?
  • can't see why you should object to the name of Algernon. It is not at
  • all a bad name. In fact, it is rather an aristocratic name. Half of the
  • chaps who get into the Bankruptcy Court are called Algernon. But
  • seriously, Cecily . . . [Moving to her] . . . if my name was Algy,
  • couldn't you love me?
  • character, but I fear that I should not be able to give you my undivided
  • attention.
  • suppose, thoroughly experienced in the practice of all the rites and
  • ceremonials of the Church?
  • written a single book, so you can imagine how much he knows.
  • on most important business.
  • and that I only met you to-day for the first time, I think it is rather
  • hard that you should leave me for so long a period as half an hour.
  • Couldn't you make it twenty minutes?
  • [Kisses her and rushes down the garden.]
  • enter his proposal in my diary.
  • [Enter Merriman.]
  • important business, Miss Fairfax states.
  • time ago.
  • back soon. And you can bring tea.
  • are associated with Uncle Jack in some of his philanthropic work in
  • work. I think it is so forward of them.
  • [Enter Merriman.]
  • [Enter Gwendolen.]
  • [Exit Merriman.]
  • My name is Cecily Cardew.
  • very sweet name! Something tells me that we are going to be great
  • friends. I like you already more than I can say. My first impressions
  • of people are never wrong.
  • other such a comparatively short time. Pray sit down.
  • mentioning who I am. My father is Lord Bracknell. You have never heard
  • of papa, I suppose?
  • entirely unknown. I think that is quite as it should be. The home seems
  • to me to be the proper sphere for the man. And certainly once a man
  • begins to neglect his domestic duties he becomes painfully effeminate,
  • does he not? And I don't like that. It makes men so very attractive.
  • Cecily, mamma, whose views on education are remarkably strict, has
  • brought me up to be extremely short-sighted; it is part of her system; so
  • do you mind my looking at you through my glasses?
  • are here on a short visit, I suppose.
  • relative of advanced years, resides here also?
  • arduous task of looking after me.
  • ward. How secretive of him! He grows more interesting hourly. I am not
  • sure, however, that the news inspires me with feelings of unmixed
  • delight. [Rising and going to her.] I am very fond of you, Cecily; I
  • have liked you ever since I met you! But I am bound to state that now
  • that I know that you are Mr. Worthing's ward, I cannot help expressing a
  • wish you were--well, just a little older than you seem to be--and not
  • quite so very alluring in appearance. In fact, if I may speak candidly--
  • say, one should always be quite candid.
  • were fully forty-two, and more than usually plain for your age. Ernest
  • has a strong upright nature. He is the very soul of truth and honour.
  • Disloyalty would be as impossible to him as deception. But even men of
  • the noblest possible moral character are extremely susceptible to the
  • influence of the physical charms of others. Modern, no less than Ancient
  • History, supplies us with many most painful examples of what I refer to.
  • If it were not so, indeed, History would be quite unreadable.
  • his brother--his elder brother.
  • had a brother.
  • time.
  • never heard any man mention his brother. The subject seems distasteful
  • to most men. Cecily, you have lifted a load from my mind. I was growing
  • almost anxious. It would have been terrible if any cloud had come across
  • a friendship like ours, would it not? Of course you are quite, quite
  • sure that it is not Mr. Ernest Worthing who is your guardian?
  • reason why I should make a secret of it to you. Our little county
  • newspaper is sure to chronicle the fact next week. Mr. Ernest Worthing
  • and I are engaged to be married.
  • must be some slight error. Mr. Ernest Worthing is engaged to me. The
  • announcement will appear in the _Morning Post_ on Saturday at the latest.
  • misconception. Ernest proposed to me exactly ten minutes ago. [Shows
  • diary.]
  • certainly very curious, for he asked me to be his wife yesterday
  • afternoon at 5.30. If you would care to verify the incident, pray do so.
  • [Produces diary of her own.] I never travel without my diary. One
  • should always have something sensational to read in the train. I am so
  • sorry, dear Cecily, if it is any disappointment to you, but I am afraid I
  • have the prior claim.
  • if it caused you any mental or physical anguish, but I feel bound to
  • point out that since Ernest proposed to you he clearly has changed his
  • mind.
  • any foolish promise I shall consider it my duty to rescue him at once,
  • and with a firm hand.
  • dear boy may have got into, I will never reproach him with it after we
  • are married.
  • are presumptuous. On an occasion of this kind it becomes more than a
  • moral duty to speak one's mind. It becomes a pleasure.
  • engagement? How dare you? This is no time for wearing the shallow mask
  • of manners. When I see a spade I call it a spade.
  • spade. It is obvious that our social spheres have been widely different.
  • [Enter Merriman, followed by the footman. He carries a salver, table
  • cloth, and plate stand. Cecily is about to retort. The presence of the
  • servants exercises a restraining influence, under which both girls
  • chafe.]
  • clear table and lay cloth. A long pause. Cecily and Gwendolen glare at
  • each other.]
  • Cardew?
  • close one can see five counties.
  • crowds.
  • bites her lip, and beats her foot nervously with her parasol.]
  • in the country, if anybody who is anybody does. The country always bores
  • me to death.
  • is it not? I believe the aristocracy are suffering very much from it
  • just at present. It is almost an epidemic amongst them, I have been
  • told. May I offer you some tea, Miss Fairfax?
  • girl! But I require tea!
  • any more. [Cecily looks angrily at her, takes up the tongs and puts four
  • lumps of sugar into the cup.]
  • rarely seen at the best houses nowadays.
  • that to Miss Fairfax.
  • [Merriman does so, and goes out with footman. Gwendolen drinks the tea
  • and makes a grimace. Puts down cup at once, reaches out her hand to the
  • bread and butter, looks at it, and finds it is cake. Rises in
  • indignation.]
  • asked most distinctly for bread and butter, you have given me cake. I am
  • known for the gentleness of my disposition, and the extraordinary
  • sweetness of my nature, but I warn you, Miss Cardew, you may go too far.
  • machinations of any other girl there are no lengths to which I would not
  • go.
  • were false and deceitful. I am never deceived in such matters. My first
  • impressions of people are invariably right.
  • valuable time. No doubt you have many other calls of a similar character
  • to make in the neighbourhood.
  • [Enter Jack.]
  • married to this young lady? [Points to Cecily.]
  • have put such an idea into your pretty little head?
  • Miss Fairfax. The gentleman whose arm is at present round your waist is
  • my guardian, Mr. John Worthing.
  • [Enter Algernon.]
  • My own love! [Offers to kiss her.]
  • engaged to be married to this young lady?
  • Gwendolen!
  • into your pretty little head?
  • [Algernon kisses her.]
  • gentleman who is now embracing you is my cousin, Mr. Algernon Moncrieff.
  • two girls move towards each other and put their arms round each other's
  • waists as if for protection.]
  • deny anything if I liked. But my name certainly is John. It has been
  • John for years.
  • us.
  • not? [They embrace. Jack and Algernon groan and walk up and down.]
  • be allowed to ask my guardian.
  • I would like to be permitted to put to you. Where is your brother
  • Ernest? We are both engaged to be married to your brother Ernest, so it
  • is a matter of some importance to us to know where your brother Ernest is
  • at present.
  • for me to be forced to speak the truth. It is the first time in my life
  • that I have ever been reduced to such a painful position, and I am really
  • quite inexperienced in doing anything of the kind. However, I will tell
  • you quite frankly that I have no brother Ernest. I have no brother at
  • all. I never had a brother in my life, and I certainly have not the
  • smallest intention of ever having one in the future.
  • engaged to be married to any one.
  • find herself in. Is it?
  • after us there.
  • [They retire into the house with scornful looks.]
  • suppose?
  • wonderful Bunbury I have ever had in my life.
  • chooses. Every serious Bunburyist knows that.
  • have any amusement in life. I happen to be serious about Bunburying.
  • What on earth you are serious about I haven't got the remotest idea.
  • About everything, I should fancy. You have such an absolutely trivial
  • nature.
  • wretched business is that your friend Bunbury is quite exploded. You
  • won't be able to run down to the country quite so often as you used to
  • do, dear Algy. And a very good thing too.
  • won't be able to disappear to London quite so frequently as your wicked
  • custom was. And not a bad thing either.
  • taking in a sweet, simple, innocent girl like that is quite inexcusable.
  • To say nothing of the fact that she is my ward.
  • brilliant, clever, thoroughly experienced young lady like Miss Fairfax.
  • To say nothing of the fact that she is my cousin.
  • Fairfax being united.
  • eat muffins.] It is very vulgar to talk about one's business. Only
  • people like stock-brokers do that, and then merely at dinner parties.
  • horrible trouble, I can't make out. You seem to me to be perfectly
  • heartless.
  • would probably get on my cuffs. One should always eat muffins quite
  • calmly. It is the only way to eat them.
  • the circumstances.
  • me. Indeed, when I am in really great trouble, as any one who knows me
  • intimately will tell you, I refuse everything except food and drink. At
  • the present moment I am eating muffins because I am unhappy. Besides, I
  • am particularly fond of muffins. [Rising.]
  • that greedy way. [Takes muffins from Algernon.]
  • I don't like tea-cake.
  • garden.
  • muffins.
  • That is a very different thing.
  • muffin-dish from Jack.]
  • It's absurd. I never go without my dinner. No one ever does, except
  • vegetarians and people like that. Besides I have just made arrangements
  • with Dr. Chasuble to be christened at a quarter to six under the name of
  • made arrangements this morning with Dr. Chasuble to be christened myself
  • at 5.30, and I naturally will take the name of Ernest. Gwendolen would
  • wish it. We can't both be christened Ernest. It's absurd. Besides, I
  • have a perfect right to be christened if I like. There is no evidence at
  • all that I have ever been christened by anybody. I should think it
  • extremely probable I never was, and so does Dr. Chasuble. It is entirely
  • different in your case. You have been christened already.
  • not quite sure about your ever having been christened, I must say I think
  • it rather dangerous your venturing on it now. It might make you very
  • unwell. You can hardly have forgotten that some one very closely
  • connected with you was very nearly carried off this week in Paris by a
  • severe chill.
  • always making wonderful improvements in things.
  • always talking nonsense.
  • There are only two left. [Takes them.] I told you I was particularly
  • fond of muffins.
  • your guests? What ideas you have of hospitality!
  • Why don't you go!
  • muffin left. [Jack groans, and sinks into a chair. Algernon still
  • continues eating.]
  • ACT DROP
  • THIRD ACT
  • SCENE
  • Morning-room at the Manor House.
  • [Gwendolen and Cecily are at the window, looking out into the garden.]
  • as any one else would have done, seems to me to show that they have some
  • sense of shame left.
  • Couldn't you cough?
  • by Algernon. They whistle some dreadful popular air from a British
  • Much depends on your reply.
  • kindly answer me the following question. Why did you pretend to be my
  • guardian's brother?
  • explanation, does it not?
  • answer.
  • is the vital thing. Mr. Worthing, what explanation can you offer to me
  • for pretending to have a brother? Was it in order that you might have an
  • opportunity of coming up to town to see me as often as possible?
  • crush them. This is not the moment for German scepticism. [Moving to
  • alone inspires one with absolute credulity.
  • one cannot surrender. Which of us should tell them? The task is not a
  • pleasant one.
  • other people. Will you take the time from me?
  • Gwendolen and Cecily [Speaking together.] Your Christian names are still
  • an insuperable barrier. That is all!
  • Jack and Algernon [Speaking together.] Our Christian names! Is that
  • all? But we are going to be christened this afternoon.
  • thing?
  • ordeal?
  • questions of self-sacrifice are concerned, men are infinitely beyond us.
  • absolutely nothing.
  • [Enter Merriman. When he enters he coughs loudly, seeing the situation.]
  • [Enter Lady Bracknell. The couples separate in alarm. Exit Merriman.]
  • Lady Bracknell. Gwendolen! What does this mean?
  • mamma.
  • Lady Bracknell. Come here. Sit down. Sit down immediately. Hesitation
  • of any kind is a sign of mental decay in the young, of physical weakness
  • in the old. [Turns to Jack.] Apprised, sir, of my daughter's sudden
  • flight by her trusty maid, whose confidence I purchased by means of a
  • small coin, I followed her at once by a luggage train. Her unhappy
  • father is, I am glad to say, under the impression that she is attending a
  • more than usually lengthy lecture by the University Extension Scheme on
  • the Influence of a permanent income on Thought. I do not propose to
  • undeceive him. Indeed I have never undeceived him on any question. I
  • would consider it wrong. But of course, you will clearly understand that
  • all communication between yourself and my daughter must cease immediately
  • from this moment. On this point, as indeed on all points, I am firm.
  • Lady Bracknell. You are nothing of the kind, sir. And now, as regards
  • Algernon! . . . Algernon!
  • Lady Bracknell. May I ask if it is in this house that your invalid
  • friend Mr. Bunbury resides?
  • is somewhere else at present. In fact, Bunbury is dead.
  • Lady Bracknell. Dead! When did Mr. Bunbury die? His death must have
  • been extremely sudden.
  • Bunbury died this afternoon.
  • Lady Bracknell. What did he die of?
  • Lady Bracknell. Exploded! Was he the victim of a revolutionary outrage?
  • I was not aware that Mr. Bunbury was interested in social legislation. If
  • so, he is well punished for his morbidity.
  • found out that Bunbury could not live, that is what I mean--so Bunbury
  • died.
  • Lady Bracknell. He seems to have had great confidence in the opinion of
  • his physicians. I am glad, however, that he made up his mind at the last
  • to some definite course of action, and acted under proper medical advice.
  • And now that we have finally got rid of this Mr. Bunbury, may I ask, Mr.
  • Worthing, who is that young person whose hand my nephew Algernon is now
  • holding in what seems to me a peculiarly unnecessary manner?
  • coldly to Cecily.]
  • Lady Bracknell. I beg your pardon?
  • Lady Bracknell. [With a shiver, crossing to the sofa and sitting down.]
  • I do not know whether there is anything peculiarly exciting in the air of
  • this particular part of Hertfordshire, but the number of engagements that
  • go on seems to me considerably above the proper average that statistics
  • have laid down for our guidance. I think some preliminary inquiry on my
  • part would not be out of place. Mr. Worthing, is Miss Cardew at all
  • connected with any of the larger railway stations in London? I merely
  • desire information. Until yesterday I had no idea that there were any
  • families or persons whose origin was a Terminus. [Jack looks perfectly
  • furious, but restrains himself.]
  • the late Mr. Thomas Cardew of 149 Belgrave Square, S.W.; Gervase Park,
  • Dorking, Surrey; and the Sporran, Fifeshire, N.B.
  • Lady Bracknell. That sounds not unsatisfactory. Three addresses always
  • inspire confidence, even in tradesmen. But what proof have I of their
  • authenticity?
  • are open to your inspection, Lady Bracknell.
  • Lady Bracknell. [Grimly.] I have known strange errors in that
  • publication.
  • Lady Bracknell. Markby, Markby, and Markby? A firm of the very highest
  • position in their profession. Indeed I am told that one of the Mr.
  • Markby's is occasionally to be seen at dinner parties. So far I am
  • satisfied.
  • have also in my possession, you will be pleased to hear, certificates of
  • Miss Cardew's birth, baptism, whooping cough, registration, vaccination,
  • confirmation, and the measles; both the German and the English variety.
  • Lady Bracknell. Ah! A life crowded with incident, I see; though perhaps
  • somewhat too exciting for a young girl. I am not myself in favour of
  • premature experiences. [Rises, looks at her watch.] Gwendolen! the time
  • approaches for our departure. We have not a moment to lose. As a matter
  • of form, Mr. Worthing, I had better ask you if Miss Cardew has any little
  • fortune?
  • is all. Goodbye, Lady Bracknell. So pleased to have seen you.
  • Lady Bracknell. [Sitting down again.] A moment, Mr. Worthing. A
  • hundred and thirty thousand pounds! And in the Funds! Miss Cardew seems
  • to me a most attractive young lady, now that I look at her. Few girls of
  • the present day have any really solid qualities, any of the qualities
  • that last, and improve with time. We live, I regret to say, in an age of
  • surfaces. [To Cecily.] Come over here, dear. [Cecily goes across.]
  • Pretty child! your dress is sadly simple, and your hair seems almost as
  • Nature might have left it. But we can soon alter all that. A thoroughly
  • experienced French maid produces a really marvellous result in a very
  • brief space of time. I remember recommending one to young Lady Lancing,
  • and after three months her own husband did not know her.
  • Lady Bracknell. [Glares at Jack for a few moments. Then bends, with a
  • practised smile, to Cecily.] Kindly turn round, sweet child. [Cecily
  • turns completely round.] No, the side view is what I want. [Cecily
  • presents her profile.] Yes, quite as I expected. There are distinct
  • social possibilities in your profile. The two weak points in our age are
  • its want of principle and its want of profile. The chin a little higher,
  • dear. Style largely depends on the way the chin is worn. They are worn
  • very high, just at present. Algernon!
  • Lady Bracknell. There are distinct social possibilities in Miss Cardew's
  • profile.
  • world. And I don't care twopence about social possibilities.
  • Lady Bracknell. Never speak disrespectfully of Society, Algernon. Only
  • people who can't get into it do that. [To Cecily.] Dear child, of
  • course you know that Algernon has nothing but his debts to depend upon.
  • But I do not approve of mercenary marriages. When I married Lord
  • Bracknell I had no fortune of any kind. But I never dreamed for a moment
  • of allowing that to stand in my way. Well, I suppose I must give my
  • consent.
  • Lady Bracknell. Cecily, you may kiss me!
  • Lady Bracknell. You may also address me as Aunt Augusta for the future.
  • Lady Bracknell. The marriage, I think, had better take place quite soon.
  • Lady Bracknell. To speak frankly, I am not in favour of long
  • engagements. They give people the opportunity of finding out each
  • other's character before marriage, which I think is never advisable.
  • engagement is quite out of the question. I am Miss Cardew's guardian,
  • and she cannot marry without my consent until she comes of age. That
  • consent I absolutely decline to give.
  • Lady Bracknell. Upon what grounds may I ask? Algernon is an extremely,
  • I may almost say an ostentatiously, eligible young man. He has nothing,
  • but he looks everything. What more can one desire?
  • Bracknell, about your nephew, but the fact is that I do not approve at
  • all of his moral character. I suspect him of being untruthful. [Algernon
  • and Cecily look at him in indignant amazement.]
  • Lady Bracknell. Untruthful! My nephew Algernon? Impossible! He is an
  • afternoon during my temporary absence in London on an important question
  • of romance, he obtained admission to my house by means of the false
  • pretence of being my brother. Under an assumed name he drank, I've just
  • been informed by my butler, an entire pint bottle of my Perrier-Jouet,
  • Brut, '89; wine I was specially reserving for myself. Continuing his
  • disgraceful deception, he succeeded in the course of the afternoon in
  • alienating the affections of my only ward. He subsequently stayed to
  • tea, and devoured every single muffin. And what makes his conduct all
  • the more heartless is, that he was perfectly well aware from the first
  • that I have no brother, that I never had a brother, and that I don't
  • intend to have a brother, not even of any kind. I distinctly told him so
  • myself yesterday afternoon.
  • Lady Bracknell. Ahem! Mr. Worthing, after careful consideration I have
  • decided entirely to overlook my nephew's conduct to you.
  • however, is unalterable. I decline to give my consent.
  • Lady Bracknell. [To Cecily.] Come here, sweet child. [Cecily goes
  • over.] How old are you, dear?
  • when I go to evening parties.
  • Lady Bracknell. You are perfectly right in making some slight
  • alteration. Indeed, no woman should ever be quite accurate about her
  • age. It looks so calculating . . . [In a meditative manner.] Eighteen,
  • but admitting to twenty at evening parties. Well, it will not be very
  • long before you are of age and free from the restraints of tutelage. So
  • I don't think your guardian's consent is, after all, a matter of any
  • importance.
  • is only fair to tell you that according to the terms of her grandfather's
  • will Miss Cardew does not come legally of age till she is thirty-five.
  • Lady Bracknell. That does not seem to me to be a grave objection. Thirty-
  • five is a very attractive age. London society is full of women of the
  • very highest birth who have, of their own free choice, remained thirty-
  • five for years. Lady Dumbleton is an instance in point. To my own
  • knowledge she has been thirty-five ever since she arrived at the age of
  • forty, which was many years ago now. I see no reason why our dear Cecily
  • should not be even still more attractive at the age you mention than she
  • is at present. There will be a large accumulation of property.
  • I hate waiting even five minutes for anybody. It always makes me rather
  • cross. I am not punctual myself, I know, but I do like punctuality in
  • others, and waiting, even to be married, is quite out of the question.
  • Lady Bracknell. My dear Mr. Worthing, as Miss Cardew states positively
  • that she cannot wait till she is thirty-five--a remark which I am bound
  • to say seems to me to show a somewhat impatient nature--I would beg of
  • you to reconsider your decision.
  • hands. The moment you consent to my marriage with Gwendolen, I will most
  • gladly allow your nephew to form an alliance with my ward.
  • Lady Bracknell. [Rising and drawing herself up.] You must be quite
  • aware that what you propose is out of the question.
  • to.
  • Lady Bracknell. That is not the destiny I propose for Gwendolen.
  • Algernon, of course, can choose for himself. [Pulls out her watch.]
  • Come, dear, [Gwendolen rises] we have already missed five, if not six,
  • trains. To miss any more might expose us to comment on the platform.
  • [Enter Dr. Chasuble.]
  • Lady Bracknell. The christenings, sir! Is not that somewhat premature?
  • Both these gentlemen have expressed a desire for immediate baptism.
  • Lady Bracknell. At their age? The idea is grotesque and irreligious!
  • Algernon, I forbid you to be baptized. I will not hear of such excesses.
  • Lord Bracknell would be highly displeased if he learned that that was the
  • way in which you wasted your time and money.
  • at all this afternoon?
  • practical value to either of us, Dr. Chasuble.
  • They savour of the heretical views of the Anabaptists, views that I have
  • completely refuted in four of my unpublished sermons. However, as your
  • present mood seems to be one peculiarly secular, I will return to the
  • church at once. Indeed, I have just been informed by the pew-opener that
  • for the last hour and a half Miss Prism has been waiting for me in the
  • vestry.
  • Lady Bracknell. [Starting.] Miss Prism! Did I hear you mention a Miss
  • Prism?
  • Lady Bracknell. Pray allow me to detain you for a moment. This matter
  • may prove to be one of vital importance to Lord Bracknell and myself. Is
  • this Miss Prism a female of repellent aspect, remotely connected with
  • education?
  • and the very picture of respectability.
  • Lady Bracknell. It is obviously the same person. May I ask what
  • position she holds in your household?
  • three years Miss Cardew's esteemed governess and valued companion.
  • Lady Bracknell. In spite of what I hear of her, I must see her at once.
  • Let her be sent for.
  • [Enter Miss Prism hurriedly.]
  • Miss Prism. I was told you expected me in the vestry, dear Canon. I
  • have been waiting for you there for an hour and three-quarters. [Catches
  • sight of Lady Bracknell, who has fixed her with a stony glare. Miss
  • Prism grows pale and quails. She looks anxiously round as if desirous to
  • escape.]
  • Lady Bracknell. [In a severe, judicial voice.] Prism! [Miss Prism bows
  • her head in shame.] Come here, Prism! [Miss Prism approaches in a
  • humble manner.] Prism! Where is that baby? [General consternation. The
  • Canon starts back in horror. Algernon and Jack pretend to be anxious to
  • shield Cecily and Gwendolen from hearing the details of a terrible public
  • scandal.] Twenty-eight years ago, Prism, you left Lord Bracknell's
  • house, Number 104, Upper Grosvenor Street, in charge of a perambulator
  • that contained a baby of the male sex. You never returned. A few weeks
  • later, through the elaborate investigations of the Metropolitan police,
  • the perambulator was discovered at midnight, standing by itself in a
  • remote corner of Bayswater. It contained the manuscript of a
  • three-volume novel of more than usually revolting sentimentality. [Miss
  • Prism starts in involuntary indignation.] But the baby was not there!
  • [Every one looks at Miss Prism.] Prism! Where is that baby? [A pause.]
  • Miss Prism. Lady Bracknell, I admit with shame that I do not know. I
  • only wish I did. The plain facts of the case are these. On the morning
  • of the day you mention, a day that is for ever branded on my memory, I
  • prepared as usual to take the baby out in its perambulator. I had also
  • with me a somewhat old, but capacious hand-bag in which I had intended to
  • place the manuscript of a work of fiction that I had written during my
  • few unoccupied hours. In a moment of mental abstraction, for which I
  • never can forgive myself, I deposited the manuscript in the basinette,
  • and placed the baby in the hand-bag.
  • the hand-bag?
  • Miss Prism. Do not ask me, Mr. Worthing.
  • insist on knowing where you deposited the hand-bag that contained that
  • infant.
  • Miss Prism. I left it in the cloak-room of one of the larger railway
  • stations in London.
  • Miss Prism. [Quite crushed.] Victoria. The Brighton line. [Sinks into
  • a chair.]
  • me.
  • life. [Exit Jack in great excitement.]
  • Lady Bracknell. I dare not even suspect, Dr. Chasuble. I need hardly
  • tell you that in families of high position strange coincidences are not
  • supposed to occur. They are hardly considered the thing.
  • [Noises heard overhead as if some one was throwing trunks about. Every
  • one looks up.]
  • Lady Bracknell. This noise is extremely unpleasant. It sounds as if he
  • was having an argument. I dislike arguments of any kind. They are
  • always vulgar, and often convincing.
  • Lady Bracknell. I wish he would arrive at some conclusion.
  • with a hand-bag of black leather in his hand.]
  • Examine it carefully before you speak. The happiness of more than one
  • life depends on your answer.
  • Miss Prism. [Calmly.] It seems to be mine. Yes, here is the injury it
  • received through the upsetting of a Gower Street omnibus in younger and
  • happier days. Here is the stain on the lining caused by the explosion of
  • a temperance beverage, an incident that occurred at Leamington. And
  • here, on the lock, are my initials. I had forgotten that in an
  • extravagant mood I had had them placed there. The bag is undoubtedly
  • mine. I am delighted to have it so unexpectedly restored to me. It has
  • been a great inconvenience being without it all these years.
  • this hand-bag. I was the baby you placed in it.
  • Miss Prism. [Amazed.] You?
  • Miss Prism. [Recoiling in indignant astonishment.] Mr. Worthing! I am
  • unmarried!
  • who has the right to cast a stone against one who has suffered? Cannot
  • repentance wipe out an act of folly? Why should there be one law for
  • men, and another for women? Mother, I forgive you. [Tries to embrace
  • her again.]
  • Miss Prism. [Still more indignant.] Mr. Worthing, there is some error.
  • [Pointing to Lady Bracknell.] There is the lady who can tell you who you
  • really are.
  • would you kindly inform me who I am?
  • Lady Bracknell. I am afraid that the news I have to give you will not
  • altogether please you. You are the son of my poor sister, Mrs.
  • Moncrieff, and consequently Algernon's elder brother.
  • had a brother! I always said I had a brother! Cecily,--how could you
  • have ever doubted that I had a brother? [Seizes hold of Algernon.] Dr.
  • Chasuble, my unfortunate brother. Miss Prism, my unfortunate brother.
  • Gwendolen, my unfortunate brother. Algy, you young scoundrel, you will
  • have to treat me with more respect in the future. You have never behaved
  • to me like a brother in all your life.
  • however, though I was out of practice.
  • [Shakes hands.]
  • Christian name, now that you have become some one else?
  • decision on the subject of my name is irrevocable, I suppose?
  • a moment. At the time when Miss Prism left me in the hand-bag, had I
  • been christened already?
  • Lady Bracknell. Every luxury that money could buy, including
  • christening, had been lavished on you by your fond and doting parents.
  • given? Let me know the worst.
  • Lady Bracknell. Being the eldest son you were naturally christened after
  • your father.
  • Lady Bracknell. [Meditatively.] I cannot at the present moment recall
  • what the General's Christian name was. But I have no doubt he had one.
  • He was eccentric, I admit. But only in later years. And that was the
  • result of the Indian climate, and marriage, and indigestion, and other
  • things of that kind.
  • before I was a year old.
  • Aunt Augusta?
  • Lady Bracknell. The General was essentially a man of peace, except in
  • his domestic life. But I have no doubt his name would appear in any
  • military directory.
  • records should have been my constant study. [Rushes to bookcase and
  • tears the books out.] M. Generals . . . Mallam, Maxbohm, Magley, what
  • ghastly names they have--Markby, Migsby, Mobbs, Moncrieff! Lieutenant
  • 1840, Captain, Lieutenant-Colonel, Colonel, General 1869, Christian
  • names, Ernest John. [Puts book very quietly down and speaks quite
  • calmly.] I always told you, Gwendolen, my name was Ernest, didn't I?
  • Well, it is Ernest after all. I mean it naturally is Ernest.
  • Lady Bracknell. Yes, I remember now that the General was called Ernest,
  • I knew I had some particular reason for disliking the name.
  • have no other name!
  • that all his life he has been speaking nothing but the truth. Can you
  • forgive me?
  • Miss Prism. [Enthusiastically.] Frederick! At last!
  • Lady Bracknell. My nephew, you seem to be displaying signs of
  • triviality.
  • time in my life the vital Importance of Being Earnest.
  • TABLEAU
##  [1] "Algernon."   "Lane."       "Jack."       "Cecily."     "Ernest."    
##  [6] "University." "Gwendolen."  "July."       "Chasuble."   "Merriman."  
## [11] "Sunday."     "Mr."         "London."     "Cardew."     "Opera."     
## [16] "Markby."     "Oxonian."

looks like your pattern wasn’t 100% successful. It missed Lady Bracknell, and picked up lines starting with University., July. and a few others.

5.1.3 Identifying the lines, take 2

The pattern “starts with a capital letter, has some other characters then a full stop” wasn’t specific enough. You ended up matching lines that started with things like University., July., London., and you missed characters like Lady Bracknell and Miss Prism.

Let’s take a different approach. You know the characters names from the play introduction. So, try specifically looking for lines that start with their names. You’ll find the or1() function from the rebus package helpful. It specifies alternatives but rather than each alternative being an argument like in or(), you can pass in a vector of alternatives.

  • Algernon. Did you hear what I was playing, Lane?
  • Lane. I didn't think it polite to listen, sir.
  • Algernon. I'm sorry for that, for your sake. I don't play
  • Lane. Yes, sir.
  • Algernon. And, speaking of the science of Life, have you got the
  • Lane. Yes, sir. [Hands them on a salver.]
  • Algernon. [Inspects them, takes two, and sits down on the sofa.] Oh! . . .
  • Lane. Yes, sir; eight bottles and a pint.
  • Algernon. Why is it that at a bachelor's establishment the servants
  • Lane. I attribute it to the superior quality of the wine, sir. I have
  • Algernon. Good heavens! Is marriage so demoralising as that?
  • Lane. I believe it _is_ a very pleasant state, sir. I have had very
  • Algernon. [Languidly_._] I don't know that I am much interested in your
  • Lane. No, sir; it is not a very interesting subject. I never think of
  • Algernon. Very natural, I am sure. That will do, Lane, thank you.
  • Lane. Thank you, sir. [Lane goes out.]
  • Algernon. Lane's views on marriage seem somewhat lax. Really, if the
  • Lane. Mr. Ernest Worthing.
  • Algernon. How are you, my dear Ernest? What brings you up to town?
  • Jack. Oh, pleasure, pleasure! What else should bring one anywhere?
  • Algernon. [Stiffly_._] I believe it is customary in good society to
  • Jack. [Sitting down on the sofa.] In the country.
  • Algernon. What on earth do you do there?
  • Jack. [Pulling off his gloves_._] When one is in town one amuses
  • Algernon. And who are the people you amuse?
  • Jack. [Airily_._] Oh, neighbours, neighbours.
  • Algernon. Got nice neighbours in your part of Shropshire?
  • Jack. Perfectly horrid! Never speak to one of them.
  • Algernon. How immensely you must amuse them! [Goes over and takes
  • Jack. Eh? Shropshire? Yes, of course. Hallo! Why all these cups? Why
  • Algernon. Oh! merely Aunt Augusta and Gwendolen.
  • Jack. How perfectly delightful!
  • Algernon. Yes, that is all very well; but I am afraid Aunt Augusta won't
  • Jack. May I ask why?
  • Algernon. My dear fellow, the way you flirt with Gwendolen is perfectly
  • Jack. I am in love with Gwendolen. I have come up to town expressly to
  • Algernon. I thought you had come up for pleasure? . . . I call that
  • Jack. How utterly unromantic you are!
  • Algernon. I really don't see anything romantic in proposing. It is very
  • Jack. I have no doubt about that, dear Algy. The Divorce Court was
  • Algernon. Oh! there is no use speculating on that subject. Divorces are
  • Jack. Well, you have been eating them all the time.
  • Algernon. That is quite a different matter. She is my aunt. [Takes
  • Jack. [Advancing to table and helping himself.] And very good bread and
  • Algernon. Well, my dear fellow, you need not eat as if you were going to
  • Jack. Why on earth do you say that?
  • Algernon. Well, in the first place girls never marry the men they flirt
  • Jack. Oh, that is nonsense!
  • Algernon. It isn't. It is a great truth. It accounts for the
  • Jack. Your consent!
  • Algernon. My dear fellow, Gwendolen is my first cousin. And before I
  • Cecily. [Rings bell.]
  • Jack. Cecily! What on earth do you mean? What do you mean, Algy, by
  • Algernon. Bring me that cigarette case Mr. Worthing left in the smoking-
  • Lane. Yes, sir. [Lane goes out.]
  • Jack. Do you mean to say you have had my cigarette case all this time? I
  • Algernon. Well, I wish you would offer one. I happen to be more than
  • Jack. There is no good offering a large reward now that the thing is
  • Algernon. I think that is rather mean of you, Ernest, I must say. [Opens
  • Jack. Of course it's mine. [Moving to him.] You have seen me with it a
  • Algernon. Oh! it is absurd to have a hard and fast rule about what one
  • Jack. I am quite aware of the fact, and I don't propose to discuss
  • Algernon. Yes; but this isn't your cigarette case. This cigarette case
  • Jack. Well, if you want to know, Cecily happens to be my aunt.
  • Algernon. Your aunt!
  • Jack. Yes. Charming old lady she is, too. Lives at Tunbridge Wells.
  • Algernon. [Retreating to back of sofa.] But why does she call herself
  • Jack. [Moving to sofa and kneeling upon it.] My dear fellow, what on
  • Algernon. Yes. But why does your aunt call you her uncle? 'From little
  • Jack. It isn't Ernest; it's Jack.
  • Algernon. You have always told me it was Ernest. I have introduced you
  • Jack. Well, my name is Ernest in town and Jack in the country, and the
  • Algernon. Yes, but that does not account for the fact that your small
  • Jack. My dear Algy, you talk exactly as if you were a dentist. It is
  • Algernon. Well, that is exactly what dentists always do. Now, go on!
  • Jack. Bunburyist? What on earth do you mean by a Bunburyist?
  • Algernon. I'll reveal to you the meaning of that incomparable expression
  • Jack. Well, produce my cigarette case first.
  • Algernon. Here it is. [Hands cigarette case.] Now produce your
  • Jack. My dear fellow, there is nothing improbable about my explanation
  • Algernon. Where is that place in the country, by the way?
  • Jack. That is nothing to you, dear boy. You are not going to be invited
  • Algernon. I suspected that, my dear fellow! I have Bunburyed all over
  • Jack. My dear Algy, I don't know whether you will be able to understand
  • Algernon. The truth is rarely pure and never simple. Modern life would
  • Jack. That wouldn't be at all a bad thing.
  • Algernon. Literary criticism is not your forte, my dear fellow. Don't
  • Jack. What on earth do you mean?
  • Algernon. You have invented a very useful younger brother called Ernest,
  • Jack. I haven't asked you to dine with me anywhere to-night.
  • Algernon. I know. You are absurdly careless about sending out
  • Jack. You had much better dine with your Aunt Augusta.
  • Algernon. I haven't the smallest intention of doing anything of the
  • Jack. I'm not a Bunburyist at all. If Gwendolen accepts me, I am going
  • Algernon. Nothing will induce me to part with Bunbury, and if you ever
  • Jack. That is nonsense. If I marry a charming girl like Gwendolen, and
  • Algernon. Then your wife will. You don't seem to realise, that in
  • Jack. [Sententiously.] That, my dear young friend, is the theory that
  • Algernon. Yes; and that the happy English home has proved in half the
  • Jack. For heaven's sake, don't try to be cynical. It's perfectly easy
  • Algernon. My dear fellow, it isn't easy to be anything nowadays. There's
  • Jack. I suppose so, if you want to.
  • Algernon. Yes, but you must be serious about it. I hate people who are
  • Lane. Lady Bracknell and Miss Fairfax.
  • Gwendolen.]
  • Lady Bracknell. Good afternoon, dear Algernon, I hope you are behaving
  • Algernon. I'm feeling very well, Aunt Augusta.
  • Lady Bracknell. That's not quite the same thing. In fact the two things
  • Algernon. [To Gwendolen.] Dear me, you are smart!
  • Gwendolen. I am always smart! Am I not, Mr. Worthing?
  • Jack. You're quite perfect, Miss Fairfax.
  • Gwendolen. Oh! I hope I am not that. It would leave no room for
  • Lady Bracknell. I'm sorry if we are a little late, Algernon, but I was
  • Algernon. Certainly, Aunt Augusta. [Goes over to tea-table.]
  • Lady Bracknell. Won't you come and sit here, Gwendolen?
  • Gwendolen. Thanks, mamma, I'm quite comfortable where I am.
  • Algernon. [Picking up empty plate in horror.] Good heavens! Lane! Why
  • Lane. [Gravely.] There were no cucumbers in the market this morning,
  • Algernon. No cucumbers!
  • Lane. No, sir. Not even for ready money.
  • Algernon. That will do, Lane, thank you.
  • Lane. Thank you, sir. [Goes out.]
  • Algernon. I am greatly distressed, Aunt Augusta, about there being no
  • Lady Bracknell. It really makes no matter, Algernon. I had some
  • Algernon. I hear her hair has turned quite gold from grief.
  • Lady Bracknell. It certainly has changed its colour. From what cause I,
  • Algernon. I am afraid, Aunt Augusta, I shall have to give up the
  • Lady Bracknell. [Frowning.] I hope not, Algernon. It would put my
  • Algernon. It is a great bore, and, I need hardly say, a terrible
  • Jack.] They seem to think I should be with him.
  • Lady Bracknell. It is very strange. This Mr. Bunbury seems to suffer
  • Algernon. Yes; poor Bunbury is a dreadful invalid.
  • Lady Bracknell. Well, I must say, Algernon, that I think it is high time
  • Algernon. I'll speak to Bunbury, Aunt Augusta, if he is still conscious,
  • Lady Bracknell. Thank you, Algernon. It is very thoughtful of you.
  • Gwendolen. Certainly, mamma.
  • Jack. Charming day it has been, Miss Fairfax.
  • Gwendolen. Pray don't talk to me about the weather, Mr. Worthing.
  • Jack. I do mean something else.
  • Gwendolen. I thought so. In fact, I am never wrong.
  • Jack. And I would like to be allowed to take advantage of Lady
  • Gwendolen. I would certainly advise you to do so. Mamma has a way of
  • Jack. [Nervously.] Miss Fairfax, ever since I met you I have admired
  • Gwendolen. Yes, I am quite well aware of the fact. And I often wish
  • Jack. You really love me, Gwendolen?
  • Gwendolen. Passionately!
  • Jack. Darling! You don't know how happy you've made me.
  • Gwendolen. My own Ernest!
  • Jack. But you don't really mean to say that you couldn't love me if my
  • Gwendolen. But your name is Ernest.
  • Jack. Yes, I know it is. But supposing it was something else? Do you
  • Gwendolen. [Glibly.] Ah! that is clearly a metaphysical speculation,
  • Jack. Personally, darling, to speak quite candidly, I don't much care
  • Gwendolen. It suits you perfectly. It is a divine name. It has a music
  • Jack. Well, really, Gwendolen, I must say that I think there are lots of
  • Gwendolen. Jack? . . . No, there is very little music in the name Jack,
  • Jack. Gwendolen, I must get christened at once--I mean we must get
  • Gwendolen. Married, Mr. Worthing?
  • Jack. [Astounded.] Well . . . surely. You know that I love you, and
  • Gwendolen. I adore you. But you haven't proposed to me yet. Nothing
  • Jack. Well . . . may I propose to you now?
  • Gwendolen. I think it would be an admirable opportunity. And to spare
  • Jack. Gwendolen!
  • Gwendolen. Yes, Mr. Worthing, what have you got to say to me?
  • Jack. You know what I have got to say to you.
  • Gwendolen. Yes, but you don't say it.
  • Jack. Gwendolen, will you marry me? [Goes on his knees.]
  • Gwendolen. Of course I will, darling. How long you have been about it!
  • Jack. My own one, I have never loved any one in the world but you.
  • Gwendolen. Yes, but men often propose for practice. I know my brother
  • Lady Bracknell. Mr. Worthing! Rise, sir, from this semi-recumbent
  • Gwendolen. Mamma! [He tries to rise; she restrains him.] I must beg
  • Lady Bracknell. Finished what, may I ask?
  • Gwendolen. I am engaged to Mr. Worthing, mamma. [They rise together.]
  • Lady Bracknell. Pardon me, you are not engaged to any one. When you do
  • Gwendolen. [Reproachfully.] Mamma!
  • Lady Bracknell. In the carriage, Gwendolen! [Gwendolen goes to the
  • Gwendolen. Yes, mamma. [Goes out, looking back at Jack.]
  • Lady Bracknell. [Sitting down.] You can take a seat, Mr. Worthing.
  • Jack. Thank you, Lady Bracknell, I prefer standing.
  • Lady Bracknell. [Pencil and note-book in hand.] I feel bound to tell
  • Jack. Well, yes, I must admit I smoke.
  • Lady Bracknell. I am glad to hear it. A man should always have an
  • Jack. Twenty-nine.
  • Lady Bracknell. A very good age to be married at. I have always been of
  • Jack. [After some hesitation.] I know nothing, Lady Bracknell.
  • Lady Bracknell. I am pleased to hear it. I do not approve of anything
  • Jack. Between seven and eight thousand a year.
  • Lady Bracknell. [Makes a note in her book.] In land, or in investments?
  • Jack. In investments, chiefly.
  • Lady Bracknell. That is satisfactory. What between the duties expected
  • Jack. I have a country house with some land, of course, attached to it,
  • Lady Bracknell. A country house! How many bedrooms? Well, that point
  • Jack. Well, I own a house in Belgrave Square, but it is let by the year
  • Lady Bracknell. Lady Bloxham? I don't know her.
  • Jack. Oh, she goes about very little. She is a lady considerably
  • Lady Bracknell. Ah, nowadays that is no guarantee of respectability of
  • Jack. 149.
  • Lady Bracknell. [Shaking her head.] The unfashionable side. I thought
  • Jack. Do you mean the fashion, or the side?
  • Lady Bracknell. [Sternly.] Both, if necessary, I presume. What are
  • Jack. Well, I am afraid I really have none. I am a Liberal Unionist.
  • Lady Bracknell. Oh, they count as Tories. They dine with us. Or come
  • Jack. I have lost both my parents.
  • Lady Bracknell. To lose one parent, Mr. Worthing, may be regarded as a
  • Jack. I am afraid I really don't know. The fact is, Lady Bracknell, I
  • Lady Bracknell. Found!
  • Jack. The late Mr. Thomas Cardew, an old gentleman of a very charitable
  • Lady Bracknell. Where did the charitable gentleman who had a first-class
  • Jack. [Gravely.] In a hand-bag.
  • Lady Bracknell. A hand-bag?
  • Jack. [Very seriously.] Yes, Lady Bracknell. I was in a hand-bag--a
  • Lady Bracknell. In what locality did this Mr. James, or Thomas, Cardew
  • Jack. In the cloak-room at Victoria Station. It was given to him in
  • Lady Bracknell. The cloak-room at Victoria Station?
  • Jack. Yes. The Brighton line.
  • Lady Bracknell. The line is immaterial. Mr. Worthing, I confess I feel
  • Jack. May I ask you then what you would advise me to do? I need hardly
  • Lady Bracknell. I would strongly advise you, Mr. Worthing, to try and
  • Jack. Well, I don't see how I could possibly manage to do that. I can
  • Lady Bracknell. Me, sir! What has it to do with me? You can hardly
  • Jack. Good morning! [Algernon, from the other room, strikes up the
  • Algernon. Didn't it go off all right, old boy? You don't mean to say
  • Jack. Oh, Gwendolen is as right as a trivet. As far as she is
  • Algernon. My dear boy, I love hearing my relations abused. It is the
  • Jack. Oh, that is nonsense!
  • Algernon. It isn't!
  • Jack. Well, I won't argue about the matter. You always want to argue
  • Algernon. That is exactly what things were originally made for.
  • Jack. Upon my word, if I thought that, I'd shoot myself . . . [A pause.]
  • Algernon. All women become like their mothers. That is their tragedy.
  • Jack. Is that clever?
  • Algernon. It is perfectly phrased! and quite as true as any observation
  • Jack. I am sick to death of cleverness. Everybody is clever nowadays.
  • Algernon. We have.
  • Jack. I should extremely like to meet them. What do they talk about?
  • Algernon. The fools? Oh! about the clever people, of course.
  • Jack. What fools!
  • Algernon. By the way, did you tell Gwendolen the truth about your being
  • Jack. [In a very patronising manner.] My dear fellow, the truth isn't
  • Algernon. The only way to behave to a woman is to make love to her, if
  • Jack. Oh, that is nonsense.
  • Algernon. What about your brother? What about the profligate Ernest?
  • Jack. Oh, before the end of the week I shall have got rid of him. I'll
  • Algernon. Yes, but it's hereditary, my dear fellow. It's a sort of
  • Jack. You are sure a severe chill isn't hereditary, or anything of that
  • Algernon. Of course it isn't!
  • Jack. Very well, then. My poor brother Ernest to carried off suddenly,
  • Algernon. But I thought you said that . . . Miss Cardew was a little too
  • Jack. Oh, that is all right. Cecily is not a silly romantic girl, I am
  • Algernon. I would rather like to see Cecily.
  • Jack. I will take very good care you never do. She is excessively
  • Algernon. Have you told Gwendolen yet that you have an excessively
  • Jack. Oh! one doesn't blurt these things out to people. Cecily and
  • Algernon. Women only do that when they have called each other a lot of
  • Jack. [Irritably.] Oh! It always is nearly seven.
  • Algernon. Well, I'm hungry.
  • Jack. I never knew you when you weren't . . .
  • Algernon. What shall we do after dinner? Go to a theatre?
  • Jack. Oh no! I loathe listening.
  • Algernon. Well, let us go to the Club?
  • Jack. Oh, no! I hate talking.
  • Algernon. Well, we might trot round to the Empire at ten?
  • Jack. Oh, no! I can't bear looking at things. It is so silly.
  • Algernon. Well, what shall we do?
  • Jack. Nothing!
  • Algernon. It is awfully hard work doing nothing. However, I don't mind
  • Lane. Miss Fairfax.
  • Algernon. Gwendolen, upon my word!
  • Gwendolen. Algy, kindly turn your back. I have something very
  • Algernon. Really, Gwendolen, I don't think I can allow this at all.
  • Gwendolen. Algy, you always adopt a strictly immoral attitude towards
  • Jack. My own darling!
  • Gwendolen. Ernest, we may never be married. From the expression on
  • Jack. Dear Gwendolen!
  • Gwendolen. The story of your romantic origin, as related to me by mamma,
  • Jack. The Manor House, Woolton, Hertfordshire.
  • Gwendolen. There is a good postal service, I suppose? It may be
  • Jack. My own one!
  • Gwendolen. How long do you remain in town?
  • Jack. Till Monday.
  • Gwendolen. Good! Algy, you may turn round now.
  • Algernon. Thanks, I've turned round already.
  • Gwendolen. You may also ring the bell.
  • Jack. You will let me see you to your carriage, my own darling?
  • Gwendolen. Certainly.
  • Jack. [To Lane, who now enters.] I will see Miss Fairfax out.
  • Lane. Yes, sir. [Jack and Gwendolen go off.]
  • Algernon. A glass of sherry, Lane.
  • Lane. Yes, sir.
  • Algernon. To-morrow, Lane, I'm going Bunburying.
  • Lane. Yes, sir.
  • Algernon. I shall probably not be back till Monday. You can put up my
  • Lane. Yes, sir. [Handing sherry.]
  • Algernon. I hope to-morrow will be a fine day, Lane.
  • Lane. It never is, sir.
  • Algernon. Lane, you're a perfect pessimist.
  • Lane. I do my best to give satisfaction, sir.
  • Jack. There's a sensible, intellectual girl! the only girl I ever cared
  • Algernon. Oh, I'm a little anxious about poor Bunbury, that is all.
  • Jack. If you don't take care, your friend Bunbury will get you into a
  • Algernon. I love scrapes. They are the only things that are never
  • Jack. Oh, that's nonsense, Algy. You never talk anything but nonsense.
  • Algernon. Nobody ever does.
  • Miss Prism. [Calling.] Cecily, Cecily! Surely such a utilitarian
  • Cecily. [Coming over very slowly.] But I don't like German. It isn't
  • Miss Prism. Child, you know how anxious your guardian is that you should
  • Cecily. Dear Uncle Jack is so very serious! Sometimes he is so serious
  • Miss Prism. [Drawing herself up.] Your guardian enjoys the best of
  • Cecily. I suppose that is why he often looks a little bored when we
  • Miss Prism. Cecily! I am surprised at you. Mr. Worthing has many
  • Cecily. I wish Uncle Jack would allow that unfortunate young man, his
  • Miss Prism. [Shaking her head.] I do not think that even I could
  • Cecily. I keep a diary in order to enter the wonderful secrets of my
  • Miss Prism. Memory, my dear Cecily, is the diary that we all carry about
  • Cecily. Yes, but it usually chronicles the things that have never
  • Miss Prism. Do not speak slightingly of the three-volume novel, Cecily.
  • Cecily. Did you really, Miss Prism? How wonderfully clever you are! I
  • Miss Prism. The good ended happily, and the bad unhappily. That is what
  • Cecily. I suppose so. But it seems very unfair. And was your novel
  • Miss Prism. Alas! no. The manuscript unfortunately was abandoned.
  • Cecily. [Smiling.] But I see dear Dr. Chasuble coming up through the
  • Miss Prism. [Rising and advancing.] Dr. Chasuble! This is indeed a
  • Chasuble. And how are we this morning? Miss Prism, you are, I trust,
  • Cecily. Miss Prism has just been complaining of a slight headache. I
  • Miss Prism. Cecily, I have not mentioned anything about a headache.
  • Cecily. No, dear Miss Prism, I know that, but I felt instinctively that
  • Chasuble. I hope, Cecily, you are not inattentive.
  • Cecily. Oh, I am afraid I am.
  • Chasuble. That is strange. Were I fortunate enough to be Miss Prism's
  • Miss Prism. We do not expect him till Monday afternoon.
  • Chasuble. Ah yes, he usually likes to spend his Sunday in London. He is
  • Miss Prism. Egeria? My name is Laetitia, Doctor.
  • Chasuble. [Bowing.] A classical allusion merely, drawn from the Pagan
  • Miss Prism. I think, dear Doctor, I will have a stroll with you. I find
  • Chasuble. With pleasure, Miss Prism, with pleasure. We might go as far
  • Miss Prism. That would be delightful. Cecily, you will read your
  • Cecily. [Picks up books and throws them back on table.] Horrid
  • Merriman. Mr. Ernest Worthing has just driven over from the station. He
  • Cecily. [Takes the card and reads it.] 'Mr. Ernest Worthing, B. 4, The
  • Merriman. Yes, Miss. He seemed very much disappointed. I mentioned
  • Cecily. Ask Mr. Ernest Worthing to come here. I suppose you had better
  • Merriman. Yes, Miss.
  • Cecily. I have never met any really wicked person before. I feel rather
  • Algernon. [Raising his hat.] You are my little cousin Cecily, I'm sure.
  • Cecily. You are under some strange mistake. I am not little. In fact,
  • Algernon. Oh! I am not really wicked at all, cousin Cecily. You mustn't
  • Cecily. If you are not, then you have certainly been deceiving us all in
  • Algernon. [Looks at her in amazement.] Oh! Of course I have been
  • Cecily. I am glad to hear it.
  • Algernon. In fact, now you mention the subject, I have been very bad in
  • Cecily. I don't think you should be so proud of that, though I am sure
  • Algernon. It is much pleasanter being here with you.
  • Cecily. I can't understand how you are here at all. Uncle Jack won't be
  • Algernon. That is a great disappointment. I am obliged to go up by the
  • Cecily. Couldn't you miss it anywhere but in London?
  • Algernon. No: the appointment is in London.
  • Cecily. Well, I know, of course, how important it is not to keep a
  • Algernon. About my what?
  • Cecily. Your emigrating. He has gone up to buy your outfit.
  • Algernon. I certainly wouldn't let Jack buy my outfit. He has no taste
  • Cecily. I don't think you will require neckties. Uncle Jack is sending
  • Algernon. Australia! I'd sooner die.
  • Cecily. Well, he said at dinner on Wednesday night, that you would have
  • Algernon. Oh, well! The accounts I have received of Australia and the
  • Cecily. Yes, but are you good enough for it?
  • Algernon. I'm afraid I'm not that. That is why I want you to reform me.
  • Cecily. I'm afraid I've no time, this afternoon.
  • Algernon. Well, would you mind my reforming myself this afternoon?
  • Cecily. It is rather Quixotic of you. But I think you should try.
  • Algernon. I will. I feel better already.
  • Cecily. You are looking a little worse.
  • Algernon. That is because I am hungry.
  • Cecily. How thoughtless of me. I should have remembered that when one
  • Algernon. Thank you. Might I have a buttonhole first? I never have any
  • Cecily. A Marechal Niel? [Picks up scissors.]
  • Algernon. No, I'd sooner have a pink rose.
  • Cecily. Why? [Cuts a flower.]
  • Algernon. Because you are like a pink rose, Cousin Cecily.
  • Cecily. I don't think it can be right for you to talk to me like that.
  • Algernon. Then Miss Prism is a short-sighted old lady. [Cecily puts the
  • Cecily. Miss Prism says that all good looks are a snare.
  • Algernon. They are a snare that every sensible man would like to be
  • Cecily. Oh, I don't think I would care to catch a sensible man. I
  • Miss Prism. You are too much alone, dear Dr. Chasuble. You should get
  • Chasuble. [With a scholar's shudder.] Believe me, I do not deserve so
  • Miss Prism. [Sententiously.] That is obviously the reason why the
  • Chasuble. But is a man not equally attractive when married?
  • Miss Prism. No married man is ever attractive except to his wife.
  • Chasuble. And often, I've been told, not even to her.
  • Miss Prism. That depends on the intellectual sympathies of the woman.
  • Chasuble. Perhaps she followed us to the schools.
  • Miss Prism. Mr. Worthing!
  • Chasuble. Mr. Worthing?
  • Miss Prism. This is indeed a surprise. We did not look for you till
  • Jack. [Shakes Miss Prism's hand in a tragic manner.] I have returned
  • Chasuble. Dear Mr. Worthing, I trust this garb of woe does not betoken
  • Jack. My brother.
  • Miss Prism. More shameful debts and extravagance?
  • Chasuble. Still leading his life of pleasure?
  • Jack. [Shaking his head.] Dead!
  • Chasuble. Your brother Ernest dead?
  • Jack. Quite dead.
  • Miss Prism. What a lesson for him! I trust he will profit by it.
  • Chasuble. Mr. Worthing, I offer you my sincere condolence. You have at
  • Jack. Poor Ernest! He had many faults, but it is a sad, sad blow.
  • Chasuble. Very sad indeed. Were you with him at the end?
  • Jack. No. He died abroad; in Paris, in fact. I had a telegram last
  • Chasuble. Was the cause of death mentioned?
  • Jack. A severe chill, it seems.
  • Miss Prism. As a man sows, so shall he reap.
  • Chasuble. [Raising his hand.] Charity, dear Miss Prism, charity! None
  • Jack. No. He seems to have expressed a desire to be buried in Paris.
  • Chasuble. In Paris! [Shakes his head.] I fear that hardly points to
  • Jack. Ah! that reminds me, you mentioned christenings I think, Dr.
  • Miss Prism. It is, I regret to say, one of the Rector's most constant
  • Chasuble. But is there any particular infant in whom you are interested,
  • Jack. Oh yes.
  • Miss Prism. [Bitterly.] People who live entirely for pleasure usually
  • Jack. But it is not for any child, dear Doctor. I am very fond of
  • Chasuble. But surely, Mr. Worthing, you have been christened already?
  • Jack. I don't remember anything about it.
  • Chasuble. But have you any grave doubts on the subject?
  • Jack. I certainly intend to have. Of course I don't know if the thing
  • Chasuble. Not at all. The sprinkling, and, indeed, the immersion of
  • Jack. Immersion!
  • Chasuble. You need have no apprehensions. Sprinkling is all that is
  • Jack. Oh, I might trot round about five if that would suit you.
  • Chasuble. Perfectly, perfectly! In fact I have two similar ceremonies
  • Jack. Oh! I don't see much fun in being christened along with other
  • Chasuble. Admirably! Admirably! [Takes out watch.] And now, dear Mr.
  • Miss Prism. This seems to me a blessing of an extremely obvious kind.
  • Cecily. Uncle Jack! Oh, I am pleased to see you back. But what horrid
  • Miss Prism. Cecily!
  • Chasuble. My child! my child! [Cecily goes towards Jack; he kisses her
  • Cecily. What is the matter, Uncle Jack? Do look happy! You look as if
  • Jack. Who?
  • Cecily. Your brother Ernest. He arrived about half an hour ago.
  • Jack. What nonsense! I haven't got a brother.
  • Cecily. Oh, don't say that. However badly he may have behaved to you in
  • Chasuble. These are very joyful tidings.
  • Miss Prism. After we had all been resigned to his loss, his sudden
  • Jack. My brother is in the dining-room? I don't know what it all means.
  • Jack. Good heavens! [Motions Algernon away.]
  • Algernon. Brother John, I have come down from town to tell you that I am
  • Cecily. Uncle Jack, you are not going to refuse your own brother's hand?
  • Jack. Nothing will induce me to take his hand. I think his coming down
  • Cecily. Uncle Jack, do be nice. There is some good in every one. Ernest
  • Jack. Oh! he has been talking about Bunbury, has he?
  • Cecily. Yes, he has told me all about poor Mr. Bunbury, and his terrible
  • Jack. Bunbury! Well, I won't have him talk to you about Bunbury or
  • Algernon. Of course I admit that the faults were all on my side. But I
  • Cecily. Uncle Jack, if you don't shake hands with Ernest I will never
  • Jack. Never forgive me?
  • Cecily. Never, never, never!
  • Jack. Well, this is the last time I shall ever do it. [Shakes with
  • Chasuble. It's pleasant, is it not, to see so perfect a reconciliation?
  • Miss Prism. Cecily, you will come with us.
  • Cecily. Certainly, Miss Prism. My little task of reconciliation is
  • Chasuble. You have done a beautiful action to-day, dear child.
  • Miss Prism. We must not be premature in our judgments.
  • Cecily. I feel very happy. [They all go off except Jack and Algernon.]
  • Jack. You young scoundrel, Algy, you must get out of this place as soon
  • Merriman. I have put Mr. Ernest's things in the room next to yours, sir.
  • Jack. What?
  • Merriman. Mr. Ernest's luggage, sir. I have unpacked it and put it in
  • Jack. His luggage?
  • Merriman. Yes, sir. Three portmanteaus, a dressing-case, two hat-boxes,
  • Algernon. I am afraid I can't stay more than a week this time.
  • Jack. Merriman, order the dog-cart at once. Mr. Ernest has been
  • Merriman. Yes, sir. [Goes back into the house.]
  • Algernon. What a fearful liar you are, Jack. I have not been called
  • Jack. Yes, you have.
  • Algernon. I haven't heard any one call me.
  • Jack. Your duty as a gentleman calls you back.
  • Algernon. My duty as a gentleman has never interfered with my pleasures
  • Jack. I can quite understand that.
  • Algernon. Well, Cecily is a darling.
  • Jack. You are not to talk of Miss Cardew like that. I don't like it.
  • Algernon. Well, I don't like your clothes. You look perfectly
  • Jack. You are certainly not staying with me for a whole week as a guest
  • Algernon. I certainly won't leave you so long as you are in mourning. It
  • Jack. Well, will you go if I change my clothes?
  • Algernon. Yes, if you are not too long. I never saw anybody take so
  • Jack. Well, at any rate, that is better than being always over-dressed
  • Algernon. If I am occasionally a little over-dressed, I make up for it
  • Jack. Your vanity is ridiculous, your conduct an outrage, and your
  • Algernon. I think it has been a great success. I'm in love with Cecily,
  • Cecily. Oh, I merely came back to water the roses. I thought you were
  • Algernon. He's gone to order the dog-cart for me.
  • Cecily. Oh, is he going to take you for a nice drive?
  • Algernon. He's going to send me away.
  • Cecily. Then have we got to part?
  • Algernon. I am afraid so. It's a very painful parting.
  • Cecily. It is always painful to part from people whom one has known for
  • Algernon. Thank you.
  • Merriman. The dog-cart is at the door, sir. [Algernon looks appealingly
  • Cecily. It can wait, Merriman for . . . five minutes.
  • Merriman. Yes, Miss. [Exit Merriman.]
  • Algernon. I hope, Cecily, I shall not offend you if I state quite
  • Cecily. I think your frankness does you great credit, Ernest. If you
  • Algernon. Do you really keep a diary? I'd give anything to look at it.
  • Cecily. Oh no. [Puts her hand over it.] You see, it is simply a very
  • Algernon. [Somewhat taken aback.] Ahem! Ahem!
  • Cecily. Oh, don't cough, Ernest. When one is dictating one should speak
  • Algernon. [Speaking very rapidly.] Cecily, ever since I first looked
  • Cecily. I don't think that you should tell me that you love me wildly,
  • Algernon. Cecily!
  • Merriman. The dog-cart is waiting, sir.
  • Algernon. Tell it to come round next week, at the same hour.
  • Merriman. [Looks at Cecily, who makes no sign.] Yes, sir.
  • Cecily. Uncle Jack would be very much annoyed if he knew you were
  • Algernon. Oh, I don't care about Jack. I don't care for anybody in the
  • Cecily. You silly boy! Of course. Why, we have been engaged for the
  • Algernon. For the last three months?
  • Cecily. Yes, it will be exactly three months on Thursday.
  • Algernon. But how did we become engaged?
  • Cecily. Well, ever since dear Uncle Jack first confessed to us that he
  • Algernon. Darling! And when was the engagement actually settled?
  • Cecily. On the 14th of February last. Worn out by your entire ignorance
  • Algernon. Did I give you this? It's very pretty, isn't it?
  • Cecily. Yes, you've wonderfully good taste, Ernest. It's the excuse
  • Algernon. My letters! But, my own sweet Cecily, I have never written
  • Cecily. You need hardly remind me of that, Ernest. I remember only too
  • Algernon. Oh, do let me read them, Cecily?
  • Cecily. Oh, I couldn't possibly. They would make you far too conceited.
  • Algernon. But was our engagement ever broken off?
  • Cecily. Of course it was. On the 22nd of last March. You can see the
  • Algernon. But why on earth did you break it off? What had I done? I
  • Cecily. It would hardly have been a really serious engagement if it
  • Algernon. [Crossing to her, and kneeling.] What a perfect angel you
  • Cecily. You dear romantic boy. [He kisses her, she puts her fingers
  • Algernon. Yes, darling, with a little help from others.
  • Cecily. I am so glad.
  • Algernon. You'll never break off our engagement again, Cecily?
  • Cecily. I don't think I could break it off now that I have actually met
  • Algernon. Yes, of course. [Nervously.]
  • Cecily. You must not laugh at me, darling, but it had always been a
  • Algernon. But, my dear child, do you mean to say you could not love me
  • Cecily. But what name?
  • Algernon. Oh, any name you like--Algernon--for instance . . .
  • Cecily. But I don't like the name of Algernon.
  • Algernon. Well, my own dear, sweet, loving little darling, I really
  • Cecily. [Rising.] I might respect you, Ernest, I might admire your
  • Algernon. Ahem! Cecily! [Picking up hat.] Your Rector here is, I
  • Cecily. Oh, yes. Dr. Chasuble is a most learned man. He has never
  • Algernon. I must see him at once on a most important christening--I mean
  • Cecily. Oh!
  • Algernon. I shan't be away more than half an hour.
  • Cecily. Considering that we have been engaged since February the 14th,
  • Algernon. I'll be back in no time.
  • Cecily. What an impetuous boy he is! I like his hair so much. I must
  • Merriman. A Miss Fairfax has just called to see Mr. Worthing. On very
  • Cecily. Isn't Mr. Worthing in his library?
  • Merriman. Mr. Worthing went over in the direction of the Rectory some
  • Cecily. Pray ask the lady to come out here; Mr. Worthing is sure to be
  • Merriman. Yes, Miss. [Goes out.]
  • Cecily. Miss Fairfax! I suppose one of the many good elderly women who
  • Merriman. Miss Fairfax.
  • Cecily. [Advancing to meet her.] Pray let me introduce myself to you.
  • Gwendolen. Cecily Cardew? [Moving to her and shaking hands.] What a
  • Cecily. How nice of you to like me so much after we have known each
  • Gwendolen. [Still standing up.] I may call you Cecily, may I not?
  • Cecily. With pleasure!
  • Gwendolen. And you will always call me Gwendolen, won't you?
  • Cecily. If you wish.
  • Gwendolen. Then that is all quite settled, is it not?
  • Cecily. I hope so. [A pause. They both sit down together.]
  • Gwendolen. Perhaps this might be a favourable opportunity for my
  • Cecily. I don't think so.
  • Gwendolen. Outside the family circle, papa, I am glad to say, is
  • Cecily. Oh! not at all, Gwendolen. I am very fond of being looked at.
  • Gwendolen. [After examining Cecily carefully through a lorgnette.] You
  • Cecily. Oh no! I live here.
  • Gwendolen. [Severely.] Really? Your mother, no doubt, or some female
  • Cecily. Oh no! I have no mother, nor, in fact, any relations.
  • Gwendolen. Indeed?
  • Cecily. My dear guardian, with the assistance of Miss Prism, has the
  • Gwendolen. Your guardian?
  • Cecily. Yes, I am Mr. Worthing's ward.
  • Gwendolen. Oh! It is strange he never mentioned to me that he had a
  • Cecily. Pray do! I think that whenever one has anything unpleasant to
  • Gwendolen. Well, to speak with perfect candour, Cecily, I wish that you
  • Cecily. I beg your pardon, Gwendolen, did you say Ernest?
  • Gwendolen. Yes.
  • Cecily. Oh, but it is not Mr. Ernest Worthing who is my guardian. It is
  • Gwendolen. [Sitting down again.] Ernest never mentioned to me that he
  • Cecily. I am sorry to say they have not been on good terms for a long
  • Gwendolen. Ah! that accounts for it. And now that I think of it I have
  • Cecily. Quite sure. [A pause.] In fact, I am going to be his.
  • Gwendolen. [Inquiringly.] I beg your pardon?
  • Cecily. [Rather shy and confidingly.] Dearest Gwendolen, there is no
  • Gwendolen. [Quite politely, rising.] My darling Cecily, I think there
  • Cecily. [Very politely, rising.] I am afraid you must be under some
  • Gwendolen. [Examines diary through her lorgnettte carefully.] It is
  • Cecily. It would distress me more than I can tell you, dear Gwendolen,
  • Gwendolen. [Meditatively.] If the poor fellow has been entrapped into
  • Cecily. [Thoughtfully and sadly.] Whatever unfortunate entanglement my
  • Gwendolen. Do you allude to me, Miss Cardew, as an entanglement? You
  • Cecily. Do you suggest, Miss Fairfax, that I entrapped Ernest into an
  • Gwendolen. [Satirically.] I am glad to say that I have never seen a
  • Merriman. Shall I lay tea here as usual, Miss?
  • Cecily. [Sternly, in a calm voice.] Yes, as usual. [Merriman begins to
  • Gwendolen. Are there many interesting walks in the vicinity, Miss
  • Cecily. Oh! yes! a great many. From the top of one of the hills quite
  • Gwendolen. Five counties! I don't think I should like that; I hate
  • Cecily. [Sweetly.] I suppose that is why you live in town? [Gwendolen
  • Gwendolen. [Looking round.] Quite a well-kept garden this is, Miss
  • Cecily. So glad you like it, Miss Fairfax.
  • Gwendolen. I had no idea there were any flowers in the country.
  • Cecily. Oh, flowers are as common here, Miss Fairfax, as people are in
  • Gwendolen. Personally I cannot understand how anybody manages to exist
  • Cecily. Ah! This is what the newspapers call agricultural depression,
  • Gwendolen. [With elaborate politeness.] Thank you. [Aside.] Detestable
  • Cecily. [Sweetly.] Sugar?
  • Gwendolen. [Superciliously.] No, thank you. Sugar is not fashionable
  • Cecily. [Severely.] Cake or bread and butter?
  • Gwendolen. [In a bored manner.] Bread and butter, please. Cake is
  • Cecily. [Cuts a very large slice of cake, and puts it on the tray.] Hand
  • Gwendolen. You have filled my tea with lumps of sugar, and though I
  • Cecily. [Rising.] To save my poor, innocent, trusting boy from the
  • Gwendolen. From the moment I saw you I distrusted you. I felt that you
  • Cecily. It seems to me, Miss Fairfax, that I am trespassing on your
  • Gwendolen. [Catching sight of him.] Ernest! My own Ernest!
  • Jack. Gwendolen! Darling! [Offers to kiss her.]
  • Gwendolen. [Draws back.] A moment! May I ask if you are engaged to be
  • Jack. [Laughing.] To dear little Cecily! Of course not! What could
  • Gwendolen. Thank you. You may! [Offers her cheek.]
  • Cecily. [Very sweetly.] I knew there must be some misunderstanding,
  • Gwendolen. I beg your pardon?
  • Cecily. This is Uncle Jack.
  • Gwendolen. [Receding.] Jack! Oh!
  • Cecily. Here is Ernest.
  • Algernon. [Goes straight over to Cecily without noticing any one else.]
  • Cecily. [Drawing back.] A moment, Ernest! May I ask you--are you
  • Algernon. [Looking round.] To what young lady? Good heavens!
  • Cecily. Yes! to good heavens, Gwendolen, I mean to Gwendolen.
  • Algernon. [Laughing.] Of course not! What could have put such an idea
  • Cecily. Thank you. [Presenting her cheek to be kissed.] You may.
  • Gwendolen. I felt there was some slight error, Miss Cardew. The
  • Cecily. [Breaking away from Algernon.] Algernon Moncrieff! Oh! [The
  • Cecily. Are you called Algernon?
  • Algernon. I cannot deny it.
  • Cecily. Oh!
  • Gwendolen. Is your name really John?
  • Jack. [Standing rather proudly.] I could deny it if I liked. I could
  • Cecily. [To Gwendolen.] A gross deception has been practised on both of
  • Gwendolen. My poor wounded Cecily!
  • Cecily. My sweet wronged Gwendolen!
  • Gwendolen. [Slowly and seriously.] You will call me sister, will you
  • Cecily. [Rather brightly.] There is just one question I would like to
  • Gwendolen. An admirable idea! Mr. Worthing, there is just one question
  • Jack. [Slowly and hesitatingly.] Gwendolen--Cecily--it is very painful
  • Cecily. [Surprised.] No brother at all?
  • Jack. [Cheerily.] None!
  • Gwendolen. [Severely.] Had you never a brother of any kind?
  • Jack. [Pleasantly.] Never. Not even of any kind.
  • Gwendolen. I am afraid it is quite clear, Cecily, that neither of us is
  • Cecily. It is not a very pleasant position for a young girl suddenly to
  • Gwendolen. Let us go into the house. They will hardly venture to come
  • Cecily. No, men are so cowardly, aren't they?
  • Jack. This ghastly state of things is what you call Bunburying, I
  • Algernon. Yes, and a perfectly wonderful Bunbury it is. The most
  • Jack. Well, you've no right whatsoever to Bunbury here.
  • Algernon. That is absurd. One has a right to Bunbury anywhere one
  • Jack. Serious Bunburyist! Good heavens!
  • Algernon. Well, one must be serious about something, if one wants to
  • Jack. Well, the only small satisfaction I have in the whole of this
  • Algernon. Your brother is a little off colour, isn't he, dear Jack? You
  • Jack. As for your conduct towards Miss Cardew, I must say that your
  • Algernon. I can see no possible defence at all for your deceiving a
  • Jack. I wanted to be engaged to Gwendolen, that is all. I love her.
  • Algernon. Well, I simply wanted to be engaged to Cecily. I adore her.
  • Jack. There is certainly no chance of your marrying Miss Cardew.
  • Algernon. I don't think there is much likelihood, Jack, of you and Miss
  • Jack. Well, that is no business of yours.
  • Algernon. If it was my business, I wouldn't talk about it. [Begins to
  • Jack. How can you sit there, calmly eating muffins when we are in this
  • Algernon. Well, I can't eat muffins in an agitated manner. The butter
  • Jack. I say it's perfectly heartless your eating muffins at all, under
  • Algernon. When I am in trouble, eating is the only thing that consoles
  • Jack. [Rising.] Well, that is no reason why you should eat them all in
  • Algernon. [Offering tea-cake.] I wish you would have tea-cake instead.
  • Jack. Good heavens! I suppose a man may eat his own muffins in his own
  • Algernon. But you have just said it was perfectly heartless to eat
  • Jack. I said it was perfectly heartless of you, under the circumstances.
  • Algernon. That may be. But the muffins are the same. [He seizes the
  • Jack. Algy, I wish to goodness you would go.
  • Algernon. You can't possibly ask me to go without having some dinner.
  • Jack. My dear fellow, the sooner you give up that nonsense the better. I
  • Algernon. Yes, but I have not been christened for years.
  • Jack. Yes, but you have been christened. That is the important thing.
  • Algernon. Quite so. So I know my constitution can stand it. If you are
  • Jack. Yes, but you said yourself that a severe chill was not hereditary.
  • Algernon. It usen't to be, I know--but I daresay it is now. Science is
  • Jack. [Picking up the muffin-dish.] Oh, that is nonsense; you are
  • Algernon. Jack, you are at the muffins again! I wish you wouldn't.
  • Jack. But I hate tea-cake.
  • Algernon. Why on earth then do you allow tea-cake to be served up for
  • Jack. Algernon! I have already told you to go. I don't want you here.
  • Algernon. I haven't quite finished my tea yet! and there is still one
  • Gwendolen. The fact that they did not follow us at once into the house,
  • Cecily. They have been eating muffins. That looks like repentance.
  • Gwendolen. [After a pause.] They don't seem to notice us at all.
  • Cecily. But I haven't got a cough.
  • Gwendolen. They're looking at us. What effrontery!
  • Cecily. They're approaching. That's very forward of them.
  • Gwendolen. Let us preserve a dignified silence.
  • Cecily. Certainly. It's the only thing to do now. [Enter Jack followed
  • Gwendolen. This dignified silence seems to produce an unpleasant effect.
  • Cecily. A most distasteful one.
  • Gwendolen. But we will not be the first to speak.
  • Cecily. Certainly not.
  • Gwendolen. Mr. Worthing, I have something very particular to ask you.
  • Cecily. Gwendolen, your common sense is invaluable. Mr. Moncrieff,
  • Algernon. In order that I might have an opportunity of meeting you.
  • Cecily. [To Gwendolen.] That certainly seems a satisfactory
  • Gwendolen. Yes, dear, if you can believe him.
  • Cecily. I don't. But that does not affect the wonderful beauty of his
  • Gwendolen. True. In matters of grave importance, style, not sincerity
  • Jack. Can you doubt it, Miss Fairfax?
  • Gwendolen. I have the gravest doubts upon the subject. But I intend to
  • Cecily.] Their explanations appear to be quite satisfactory, especially
  • Cecily. I am more than content with what Mr. Moncrieff said. His voice
  • Gwendolen. Then you think we should forgive them?
  • Cecily. Yes. I mean no.
  • Gwendolen. True! I had forgotten. There are principles at stake that
  • Cecily. Could we not both speak at the same time?
  • Gwendolen. An excellent idea! I nearly always speak at the same time as
  • Cecily. Certainly. [Gwendolen beats time with uplifted finger.]
  • Gwendolen. [To Jack.] For my sake you are prepared to do this terrible
  • Jack. I am.
  • Cecily. [To Algernon.] To please me you are ready to face this fearful
  • Algernon. I am!
  • Gwendolen. How absurd to talk of the equality of the sexes! Where
  • Jack. We are. [Clasps hands with Algernon.]
  • Cecily. They have moments of physical courage of which we women know
  • Gwendolen. [To Jack.] Darling!
  • Algernon. [To Cecily.] Darling! [They fall into each other's arms.]
  • Merriman. Ahem! Ahem! Lady Bracknell!
  • Jack. Good heavens!
  • Lady Bracknell. Gwendolen! What does this mean?
  • Gwendolen. Merely that I am engaged to be married to Mr. Worthing,
  • Lady Bracknell. Come here. Sit down. Sit down immediately. Hesitation
  • Jack. I am engaged to be married to Gwendolen, Lady Bracknell!
  • Lady Bracknell. You are nothing of the kind, sir. And now, as regards
  • Algernon. Yes, Aunt Augusta.
  • Lady Bracknell. May I ask if it is in this house that your invalid
  • Algernon. [Stammering.] Oh! No! Bunbury doesn't live here. Bunbury
  • Lady Bracknell. Dead! When did Mr. Bunbury die? His death must have
  • Algernon. [Airily.] Oh! I killed Bunbury this afternoon. I mean poor
  • Lady Bracknell. What did he die of?
  • Algernon. Bunbury? Oh, he was quite exploded.
  • Lady Bracknell. Exploded! Was he the victim of a revolutionary outrage?
  • Algernon. My dear Aunt Augusta, I mean he was found out! The doctors
  • Lady Bracknell. He seems to have had great confidence in the opinion of
  • Jack. That lady is Miss Cecily Cardew, my ward. [Lady Bracknell bows
  • Algernon. I am engaged to be married to Cecily, Aunt Augusta.
  • Lady Bracknell. I beg your pardon?
  • Cecily. Mr. Moncrieff and I are engaged to be married, Lady Bracknell.
  • Lady Bracknell. [With a shiver, crossing to the sofa and sitting down.]
  • Jack. [In a clear, cold voice.] Miss Cardew is the grand-daughter of
  • Lady Bracknell. That sounds not unsatisfactory. Three addresses always
  • Jack. I have carefully preserved the Court Guides of the period. They
  • Lady Bracknell. [Grimly.] I have known strange errors in that
  • Jack. Miss Cardew's family solicitors are Messrs. Markby, Markby, and
  • Lady Bracknell. Markby, Markby, and Markby? A firm of the very highest
  • Jack. [Very irritably.] How extremely kind of you, Lady Bracknell! I
  • Lady Bracknell. Ah! A life crowded with incident, I see; though perhaps
  • Jack. Oh! about a hundred and thirty thousand pounds in the Funds. That
  • Lady Bracknell. [Sitting down again.] A moment, Mr. Worthing. A
  • Jack. And after six months nobody knew her.
  • Lady Bracknell. [Glares at Jack for a few moments. Then bends, with a
  • Algernon. Yes, Aunt Augusta!
  • Lady Bracknell. There are distinct social possibilities in Miss Cardew's
  • Algernon. Cecily is the sweetest, dearest, prettiest girl in the whole
  • Lady Bracknell. Never speak disrespectfully of Society, Algernon. Only
  • Algernon. Thank you, Aunt Augusta.
  • Lady Bracknell. Cecily, you may kiss me!
  • Cecily. [Kisses her.] Thank you, Lady Bracknell.
  • Lady Bracknell. You may also address me as Aunt Augusta for the future.
  • Cecily. Thank you, Aunt Augusta.
  • Lady Bracknell. The marriage, I think, had better take place quite soon.
  • Algernon. Thank you, Aunt Augusta.
  • Cecily. Thank you, Aunt Augusta.
  • Lady Bracknell. To speak frankly, I am not in favour of long
  • Jack. I beg your pardon for interrupting you, Lady Bracknell, but this
  • Lady Bracknell. Upon what grounds may I ask? Algernon is an extremely,
  • Jack. It pains me very much to have to speak frankly to you, Lady
  • Lady Bracknell. Untruthful! My nephew Algernon? Impossible! He is an
  • Jack. I fear there can be no possible doubt about the matter. This
  • Lady Bracknell. Ahem! Mr. Worthing, after careful consideration I have
  • Jack. That is very generous of you, Lady Bracknell. My own decision,
  • Lady Bracknell. [To Cecily.] Come here, sweet child. [Cecily goes
  • Cecily. Well, I am really only eighteen, but I always admit to twenty
  • Lady Bracknell. You are perfectly right in making some slight
  • Jack. Pray excuse me, Lady Bracknell, for interrupting you again, but it
  • Lady Bracknell. That does not seem to me to be a grave objection. Thirty-
  • Cecily. Algy, could you wait for me till I was thirty-five?
  • Algernon. Of course I could, Cecily. You know I could.
  • Cecily. Yes, I felt it instinctively, but I couldn't wait all that time.
  • Algernon. Then what is to be done, Cecily?
  • Cecily. I don't know, Mr. Moncrieff.
  • Lady Bracknell. My dear Mr. Worthing, as Miss Cardew states positively
  • Jack. But my dear Lady Bracknell, the matter is entirely in your own
  • Lady Bracknell. [Rising and drawing herself up.] You must be quite
  • Jack. Then a passionate celibacy is all that any of us can look forward
  • Lady Bracknell. That is not the destiny I propose for Gwendolen.
  • Chasuble. Everything is quite ready for the christenings.
  • Lady Bracknell. The christenings, sir! Is not that somewhat premature?
  • Chasuble. [Looking rather puzzled, and pointing to Jack and Algernon.]
  • Lady Bracknell. At their age? The idea is grotesque and irreligious!
  • Chasuble. Am I to understand then that there are to be no christenings
  • Jack. I don't think that, as things are now, it would be of much
  • Chasuble. I am grieved to hear such sentiments from you, Mr. Worthing.
  • Lady Bracknell. [Starting.] Miss Prism! Did I hear you mention a Miss
  • Chasuble. Yes, Lady Bracknell. I am on my way to join her.
  • Lady Bracknell. Pray allow me to detain you for a moment. This matter
  • Chasuble. [Somewhat indignantly.] She is the most cultivated of ladies,
  • Lady Bracknell. It is obviously the same person. May I ask what
  • Chasuble. [Severely.] I am a celibate, madam.
  • Jack. [Interposing.] Miss Prism, Lady Bracknell, has been for the last
  • Lady Bracknell. In spite of what I hear of her, I must see her at once.
  • Chasuble. [Looking off.] She approaches; she is nigh.
  • Miss Prism. I was told you expected me in the vestry, dear Canon. I
  • Lady Bracknell. [In a severe, judicial voice.] Prism! [Miss Prism bows
  • Miss Prism. Lady Bracknell, I admit with shame that I do not know. I
  • Jack. [Who has been listening attentively.] But where did you deposit
  • Miss Prism. Do not ask me, Mr. Worthing.
  • Jack. Miss Prism, this is a matter of no small importance to me. I
  • Miss Prism. I left it in the cloak-room of one of the larger railway
  • Jack. What railway station?
  • Miss Prism. [Quite crushed.] Victoria. The Brighton line. [Sinks into
  • Jack. I must retire to my room for a moment. Gwendolen, wait here for
  • Gwendolen. If you are not too long, I will wait here for you all my
  • Chasuble. What do you think this means, Lady Bracknell?
  • Lady Bracknell. I dare not even suspect, Dr. Chasuble. I need hardly
  • Cecily. Uncle Jack seems strangely agitated.
  • Chasuble. Your guardian has a very emotional nature.
  • Lady Bracknell. This noise is extremely unpleasant. It sounds as if he
  • Chasuble. [Looking up.] It has stopped now. [The noise is redoubled.]
  • Lady Bracknell. I wish he would arrive at some conclusion.
  • Gwendolen. This suspense is terrible. I hope it will last. [Enter Jack
  • Jack. [Rushing over to Miss Prism.] Is this the hand-bag, Miss Prism?
  • Miss Prism. [Calmly.] It seems to be mine. Yes, here is the injury it
  • Jack. [In a pathetic voice.] Miss Prism, more is restored to you than
  • Miss Prism. [Amazed.] You?
  • Jack. [Embracing her.] Yes . . . mother!
  • Miss Prism. [Recoiling in indignant astonishment.] Mr. Worthing! I am
  • Jack. Unmarried! I do not deny that is a serious blow. But after all,
  • Miss Prism. [Still more indignant.] Mr. Worthing, there is some error.
  • Jack. [After a pause.] Lady Bracknell, I hate to seem inquisitive, but
  • Lady Bracknell. I am afraid that the news I have to give you will not
  • Jack. Algy's elder brother! Then I have a brother after all. I knew I
  • Algernon. Well, not till to-day, old boy, I admit. I did my best,
  • Gwendolen. [To Jack.] My own! But what own are you? What is your
  • Jack. Good heavens! . . . I had quite forgotten that point. Your
  • Gwendolen. I never change, except in my affections.
  • Cecily. What a noble nature you have, Gwendolen!
  • Jack. Then the question had better be cleared up at once. Aunt Augusta,
  • Lady Bracknell. Every luxury that money could buy, including
  • Jack. Then I was christened! That is settled. Now, what name was I
  • Lady Bracknell. Being the eldest son you were naturally christened after
  • Jack. [Irritably.] Yes, but what was my father's Christian name?
  • Lady Bracknell. [Meditatively.] I cannot at the present moment recall
  • Jack. Algy! Can't you recollect what our father's Christian name was?
  • Algernon. My dear boy, we were never even on speaking terms. He died
  • Jack. His name would appear in the Army Lists of the period, I suppose,
  • Lady Bracknell. The General was essentially a man of peace, except in
  • Jack. The Army Lists of the last forty years are here. These delightful
  • Lady Bracknell. Yes, I remember now that the General was called Ernest,
  • Gwendolen. Ernest! My own Ernest! I felt from the first that you could
  • Jack. Gwendolen, it is a terrible thing for a man to find out suddenly
  • Gwendolen. I can. For I feel that you are sure to change.
  • Jack. My own one!
  • Chasuble. [To Miss Prism.] Laetitia! [Embraces her]
  • Miss Prism. [Enthusiastically.] Frederick! At last!
  • Algernon. Cecily! [Embraces her.] At last!
  • Jack. Gwendolen! [Embraces her.] At last!
  • Lady Bracknell. My nephew, you seem to be displaying signs of
  • Jack. On the contrary, Aunt Augusta, I've now realised for the first
  • FIRST ACT
  • SCENE
  • Morning-room in Algernon's flat in Half-Moon Street. The room is
  • luxuriously and artistically furnished. The sound of a piano is heard in
  • the adjoining room.
  • [Lane is arranging afternoon tea on the table, and after the music has
  • ceased, Algernon enters.]
  • accurately--any one can play accurately--but I play with wonderful
  • expression. As far as the piano is concerned, sentiment is my forte. I
  • keep science for Life.
  • cucumber sandwiches cut for Lady Bracknell?
  • by the way, Lane, I see from your book that on Thursday night, when
  • Lord Shoreman and Mr. Worthing were dining with me, eight bottles of
  • champagne are entered as having been consumed.
  • invariably drink the champagne? I ask merely for information.
  • often observed that in married households the champagne is rarely of a
  • first-rate brand.
  • little experience of it myself up to the present. I have only been
  • married once. That was in consequence of a misunderstanding between
  • myself and a young person.
  • family life, Lane.
  • it myself.
  • lower orders don't set us a good example, what on earth is the use of
  • them? They seem, as a class, to have absolutely no sense of moral
  • responsibility.
  • [Enter Lane.]
  • [Enter Jack.]
  • [Lane goes out_._]
  • Eating as usual, I see, Algy!
  • take some slight refreshment at five o'clock. Where have you been since
  • last Thursday?
  • oneself. When one is in the country one amuses other people. It is
  • excessively boring.
  • sandwich.] By the way, Shropshire is your county, is it not?
  • cucumber sandwiches? Why such reckless extravagance in one so young? Who
  • is coming to tea?
  • quite approve of your being here.
  • disgraceful. It is almost as bad as the way Gwendolen flirts with you.
  • propose to her.
  • business.
  • romantic to be in love. But there is nothing romantic about a definite
  • proposal. Why, one may be accepted. One usually is, I believe. Then
  • the excitement is all over. The very essence of romance is uncertainty.
  • If ever I get married, I'll certainly try to forget the fact.
  • specially invented for people whose memories are so curiously
  • constituted.
  • made in Heaven--[Jack puts out his hand to take a sandwich. Algernon at
  • once interferes.] Please don't touch the cucumber sandwiches. They are
  • ordered specially for Aunt Augusta. [Takes one and eats it.]
  • plate from below.] Have some bread and butter. The bread and butter is
  • for Gwendolen. Gwendolen is devoted to bread and butter.
  • butter it is too.
  • eat it all. You behave as if you were married to her already. You are
  • not married to her already, and I don't think you ever will be.
  • with. Girls don't think it right.
  • extraordinary number of bachelors that one sees all over the place. In
  • the second place, I don't give my consent.
  • allow you to marry her, you will have to clear up the whole question of
  • Cecily! I don't know any one of the name of Cecily.
  • [Enter Lane.]
  • room the last time he dined here.
  • wish to goodness you had let me know. I have been writing frantic
  • letters to Scotland Yard about it. I was very nearly offering a large
  • reward.
  • usually hard up.
  • found.
  • [Enter Lane with the cigarette case on a salver. Algernon takes it at
  • once. Lane goes out.]
  • case and examines it.] However, it makes no matter, for, now that I look
  • at the inscription inside, I find that the thing isn't yours after all.
  • hundred times, and you have no right whatsoever to read what is written
  • inside. It is a very ungentlemanly thing to read a private cigarette
  • case.
  • should read and what one shouldn't. More than half of modern culture
  • depends on what one shouldn't read.
  • modern culture. It isn't the sort of thing one should talk of in
  • private. I simply want my cigarette case back.
  • is a present from some one of the name of Cecily, and you said you didn't
  • know any one of that name.
  • Just give it back to me, Algy.
  • little Cecily if she is your aunt and lives at Tunbridge Wells?
  • [Reading.] 'From little Cecily with her fondest love.'
  • earth is there in that? Some aunts are tall, some aunts are not tall.
  • That is a matter that surely an aunt may be allowed to decide for
  • herself. You seem to think that every aunt should be exactly like your
  • aunt! That is absurd! For Heaven's sake give me back my cigarette case.
  • [Follows Algernon round the room.]
  • Cecily, with her fondest love to her dear Uncle Jack.' There is no
  • objection, I admit, to an aunt being a small aunt, but why an aunt, no
  • matter what her size may be, should call her own nephew her uncle, I
  • can't quite make out. Besides, your name isn't Jack at all; it is
  • Ernest.
  • to every one as Ernest. You answer to the name of Ernest. You look as
  • if your name was Ernest. You are the most earnest-looking person I ever
  • saw in my life. It is perfectly absurd your saying that your name isn't
  • Ernest. It's on your cards. Here is one of them. [Taking it from
  • case.] 'Mr. Ernest Worthing, B. 4, The Albany.' I'll keep this as a
  • proof that your name is Ernest if ever you attempt to deny it to me, or
  • to Gwendolen, or to any one else. [Puts the card in his pocket.]
  • cigarette case was given to me in the country.
  • Aunt Cecily, who lives at Tunbridge Wells, calls you her dear uncle.
  • Come, old boy, you had much better have the thing out at once.
  • very vulgar to talk like a dentist when one isn't a dentist. It produces
  • a false impression.
  • Tell me the whole thing. I may mention that I have always suspected you
  • of being a confirmed and secret Bunburyist; and I am quite sure of it
  • now.
  • as soon as you are kind enough to inform me why you are Ernest in town
  • and Jack in the country.
  • explanation, and pray make it improbable. [Sits on sofa.]
  • at all. In fact it's perfectly ordinary. Old Mr. Thomas Cardew, who
  • adopted me when I was a little boy, made me in his will guardian to his
  • grand-daughter, Miss Cecily Cardew. Cecily, who addresses me as her
  • uncle from motives of respect that you could not possibly appreciate,
  • lives at my place in the country under the charge of her admirable
  • governess, Miss Prism.
  • . . . I may tell you candidly that the place is not in Shropshire.
  • Shropshire on two separate occasions. Now, go on. Why are you Ernest in
  • town and Jack in the country?
  • my real motives. You are hardly serious enough. When one is placed in
  • the position of guardian, one has to adopt a very high moral tone on all
  • subjects. It's one's duty to do so. And as a high moral tone can hardly
  • be said to conduce very much to either one's health or one's happiness,
  • in order to get up to town I have always pretended to have a younger
  • brother of the name of Ernest, who lives in the Albany, and gets into the
  • most dreadful scrapes. That, my dear Algy, is the whole truth pure and
  • simple.
  • be very tedious if it were either, and modern literature a complete
  • impossibility!
  • try it. You should leave that to people who haven't been at a
  • University. They do it so well in the daily papers. What you really are
  • is a Bunburyist. I was quite right in saying you were a Bunburyist. You
  • are one of the most advanced Bunburyists I know.
  • in order that you may be able to come up to town as often as you like. I
  • have invented an invaluable permanent invalid called Bunbury, in order
  • that I may be able to go down into the country whenever I choose. Bunbury
  • is perfectly invaluable. If it wasn't for Bunbury's extraordinary bad
  • health, for instance, I wouldn't be able to dine with you at Willis's to-
  • night, for I have been really engaged to Aunt Augusta for more than a
  • week.
  • invitations. It is very foolish of you. Nothing annoys people so much
  • as not receiving invitations.
  • kind. To begin with, I dined there on Monday, and once a week is quite
  • enough to dine with one's own relations. In the second place, whenever I
  • do dine there I am always treated as a member of the family, and sent
  • down with either no woman at all, or two. In the third place, I know
  • perfectly well whom she will place me next to, to-night. She will place
  • me next Mary Farquhar, who always flirts with her own husband across the
  • dinner-table. That is not very pleasant. Indeed, it is not even decent
  • . . . and that sort of thing is enormously on the increase. The amount
  • of women in London who flirt with their own husbands is perfectly
  • scandalous. It looks so bad. It is simply washing one's clean linen in
  • public. Besides, now that I know you to be a confirmed Bunburyist I
  • naturally want to talk to you about Bunburying. I want to tell you the
  • rules.
  • to kill my brother, indeed I think I'll kill him in any case. Cecily is
  • a little too much interested in him. It is rather a bore. So I am going
  • to get rid of Ernest. And I strongly advise you to do the same with Mr.
  • . . . with your invalid friend who has the absurd name.
  • get married, which seems to me extremely problematic, you will be very
  • glad to know Bunbury. A man who marries without knowing Bunbury has a
  • very tedious time of it.
  • she is the only girl I ever saw in my life that I would marry, I
  • certainly won't want to know Bunbury.
  • married life three is company and two is none.
  • the corrupt French Drama has been propounding for the last fifty years.
  • time.
  • to be cynical.
  • such a lot of beastly competition about. [The sound of an electric bell
  • is heard.] Ah! that must be Aunt Augusta. Only relatives, or creditors,
  • ever ring in that Wagnerian manner. Now, if I get her out of the way for
  • ten minutes, so that you can have an opportunity for proposing to
  • Gwendolen, may I dine with you to-night at Willis's?
  • not serious about meals. It is so shallow of them.
  • [Enter Lane.]
  • [Algernon goes forward to meet them. Enter Lady Bracknell and
  • very well.
  • rarely go together. [Sees Jack and bows to him with icy coldness.]
  • developments, and I intend to develop in many directions. [Gwendolen and
  • Jack sit down together in the corner.]
  • obliged to call on dear Lady Harbury. I hadn't been there since her poor
  • husband's death. I never saw a woman so altered; she looks quite twenty
  • years younger. And now I'll have a cup of tea, and one of those nice
  • cucumber sandwiches you promised me.
  • are there no cucumber sandwiches? I ordered them specially.
  • sir. I went down twice.
  • cucumbers, not even for ready money.
  • crumpets with Lady Harbury, who seems to me to be living entirely for
  • pleasure now.
  • of course, cannot say. [Algernon crosses and hands tea.] Thank you.
  • I've quite a treat for you to-night, Algernon. I am going to send you
  • down with Mary Farquhar. She is such a nice woman, and so attentive to
  • her husband. It's delightful to watch them.
  • pleasure of dining with you to-night after all.
  • table completely out. Your uncle would have to dine upstairs.
  • Fortunately he is accustomed to that.
  • disappointment to me, but the fact is I have just had a telegram to say
  • that my poor friend Bunbury is very ill again. [Exchanges glances with
  • from curiously bad health.
  • that Mr. Bunbury made up his mind whether he was going to live or to die.
  • This shilly-shallying with the question is absurd. Nor do I in any way
  • approve of the modern sympathy with invalids. I consider it morbid.
  • Illness of any kind is hardly a thing to be encouraged in others. Health
  • is the primary duty of life. I am always telling that to your poor
  • uncle, but he never seems to take much notice . . . as far as any
  • improvement in his ailment goes. I should be much obliged if you would
  • ask Mr. Bunbury, from me, to be kind enough not to have a relapse on
  • Saturday, for I rely on you to arrange my music for me. It is my last
  • reception, and one wants something that will encourage conversation,
  • particularly at the end of the season when every one has practically said
  • whatever they had to say, which, in most cases, was probably not much.
  • and I think I can promise you he'll be all right by Saturday. Of course
  • the music is a great difficulty. You see, if one plays good music,
  • people don't listen, and if one plays bad music people don't talk. But
  • I'll run over the programme I've drawn out, if you will kindly come into
  • the next room for a moment.
  • [Rising, and following Algernon.] I'm sure the programme will be
  • delightful, after a few expurgations. French songs I cannot possibly
  • allow. People always seem to think that they are improper, and either
  • look shocked, which is vulgar, or laugh, which is worse. But German
  • sounds a thoroughly respectable language, and indeed, I believe is so.
  • Gwendolen, you will accompany me.
  • [Lady Bracknell and Algernon go into the music-room, Gwendolen remains
  • behind.]
  • Whenever people talk to me about the weather, I always feel quite certain
  • that they mean something else. And that makes me so nervous.
  • Bracknell's temporary absence . . .
  • coming back suddenly into a room that I have often had to speak to her
  • about.
  • you more than any girl . . . I have ever met since . . . I met you.
  • that in public, at any rate, you had been more demonstrative. For me you
  • have always had an irresistible fascination. Even before I met you I was
  • far from indifferent to you. [Jack looks at her in amazement.] We live,
  • as I hope you know, Mr. Worthing, in an age of ideals. The fact is
  • constantly mentioned in the more expensive monthly magazines, and has
  • reached the provincial pulpits, I am told; and my ideal has always been
  • to love some one of the name of Ernest. There is something in that name
  • that inspires absolute confidence. The moment Algernon first mentioned
  • to me that he had a friend called Ernest, I knew I was destined to love
  • you.
  • name wasn't Ernest?
  • mean to say you couldn't love me then?
  • and like most metaphysical speculations has very little reference at all
  • to the actual facts of real life, as we know them.
  • about the name of Ernest . . . I don't think the name suits me at all.
  • of its own. It produces vibrations.
  • other much nicer names. I think Jack, for instance, a charming name.
  • if any at all, indeed. It does not thrill. It produces absolutely no
  • vibrations . . . I have known several Jacks, and they all, without
  • exception, were more than usually plain. Besides, Jack is a notorious
  • domesticity for John! And I pity any woman who is married to a man
  • called John. She would probably never be allowed to know the entrancing
  • pleasure of a single moment's solitude. The only really safe name is
  • Ernest.
  • married at once. There is no time to be lost.
  • you led me to believe, Miss Fairfax, that you were not absolutely
  • indifferent to me.
  • has been said at all about marriage. The subject has not even been
  • touched on.
  • you any possible disappointment, Mr. Worthing, I think it only fair to
  • tell you quite frankly before-hand that I am fully determined to accept
  • you.
  • I am afraid you have had very little experience in how to propose.
  • Gerald does. All my girl-friends tell me so. What wonderfully blue eyes
  • you have, Ernest! They are quite, quite, blue. I hope you will always
  • look at me just like that, especially when there are other people
  • present. [Enter Lady Bracknell.]
  • posture. It is most indecorous.
  • you to retire. This is no place for you. Besides, Mr. Worthing has not
  • quite finished yet.
  • become engaged to some one, I, or your father, should his health permit
  • him, will inform you of the fact. An engagement should come on a young
  • girl as a surprise, pleasant or unpleasant, as the case may be. It is
  • hardly a matter that she could be allowed to arrange for herself . . .
  • And now I have a few questions to put to you, Mr. Worthing. While I am
  • making these inquiries, you, Gwendolen, will wait for me below in the
  • carriage.
  • door. She and Jack blow kisses to each other behind Lady Bracknell's
  • back. Lady Bracknell looks vaguely about as if she could not understand
  • what the noise was. Finally turns round.] Gwendolen, the carriage!
  • [Looks in her pocket for note-book and pencil.]
  • you that you are not down on my list of eligible young men, although I
  • have the same list as the dear Duchess of Bolton has. We work together,
  • in fact. However, I am quite ready to enter your name, should your
  • answers be what a really affectionate mother requires. Do you smoke?
  • occupation of some kind. There are far too many idle men in London as it
  • is. How old are you?
  • opinion that a man who desires to get married should know either
  • everything or nothing. Which do you know?
  • that tampers with natural ignorance. Ignorance is like a delicate exotic
  • fruit; touch it and the bloom is gone. The whole theory of modern
  • education is radically unsound. Fortunately in England, at any rate,
  • education produces no effect whatsoever. If it did, it would prove a
  • serious danger to the upper classes, and probably lead to acts of
  • violence in Grosvenor Square. What is your income?
  • of one during one's lifetime, and the duties exacted from one after one's
  • death, land has ceased to be either a profit or a pleasure. It gives one
  • position, and prevents one from keeping it up. That's all that can be
  • said about land.
  • about fifteen hundred acres, I believe; but I don't depend on that for my
  • real income. In fact, as far as I can make out, the poachers are the
  • only people who make anything out of it.
  • can be cleared up afterwards. You have a town house, I hope? A girl
  • with a simple, unspoiled nature, like Gwendolen, could hardly be expected
  • to reside in the country.
  • to Lady Bloxham. Of course, I can get it back whenever I like, at six
  • months' notice.
  • advanced in years.
  • character. What number in Belgrave Square?
  • there was something. However, that could easily be altered.
  • your politics?
  • in the evening, at any rate. Now to minor matters. Are your parents
  • living?
  • misfortune; to lose both looks like carelessness. Who was your father?
  • He was evidently a man of some wealth. Was he born in what the Radical
  • papers call the purple of commerce, or did he rise from the ranks of the
  • aristocracy?
  • said I had lost my parents. It would be nearer the truth to say that my
  • parents seem to have lost me . . . I don't actually know who I am by
  • birth. I was . . . well, I was found.
  • and kindly disposition, found me, and gave me the name of Worthing,
  • because he happened to have a first-class ticket for Worthing in his
  • pocket at the time. Worthing is a place in Sussex. It is a seaside
  • resort.
  • ticket for this seaside resort find you?
  • somewhat large, black leather hand-bag, with handles to it--an ordinary
  • hand-bag in fact.
  • come across this ordinary hand-bag?
  • mistake for his own.
  • somewhat bewildered by what you have just told me. To be born, or at any
  • rate bred, in a hand-bag, whether it had handles or not, seems to me to
  • display a contempt for the ordinary decencies of family life that reminds
  • one of the worst excesses of the French Revolution. And I presume you
  • know what that unfortunate movement led to? As for the particular
  • locality in which the hand-bag was found, a cloak-room at a railway
  • station might serve to conceal a social indiscretion--has probably,
  • indeed, been used for that purpose before now--but it could hardly be
  • regarded as an assured basis for a recognised position in good society.
  • say I would do anything in the world to ensure Gwendolen's happiness.
  • acquire some relations as soon as possible, and to make a definite effort
  • to produce at any rate one parent, of either sex, before the season is
  • quite over.
  • produce the hand-bag at any moment. It is in my dressing-room at home. I
  • really think that should satisfy you, Lady Bracknell.
  • imagine that I and Lord Bracknell would dream of allowing our only
  • daughter--a girl brought up with the utmost care--to marry into a cloak-
  • room, and form an alliance with a parcel? Good morning, Mr. Worthing!
  • [Lady Bracknell sweeps out in majestic indignation.]
  • Wedding March. Jack looks perfectly furious, and goes to the door.] For
  • goodness' sake don't play that ghastly tune, Algy. How idiotic you are!
  • [The music stops and Algernon enters cheerily.]
  • Gwendolen refused you? I know it is a way she has. She is always
  • refusing people. I think it is most ill-natured of her.
  • concerned, we are engaged. Her mother is perfectly unbearable. Never
  • met such a Gorgon . . . I don't really know what a Gorgon is like, but I
  • am quite sure that Lady Bracknell is one. In any case, she is a monster,
  • without being a myth, which is rather unfair . . . I beg your pardon,
  • Algy, I suppose I shouldn't talk about your own aunt in that way before
  • you.
  • only thing that makes me put up with them at all. Relations are simply a
  • tedious pack of people, who haven't got the remotest knowledge of how to
  • live, nor the smallest instinct about when to die.
  • about things.
  • You don't think there is any chance of Gwendolen becoming like her mother
  • in about a hundred and fifty years, do you, Algy?
  • No man does. That's his.
  • in civilised life should be.
  • You can't go anywhere without meeting clever people. The thing has
  • become an absolute public nuisance. I wish to goodness we had a few
  • fools left.
  • Ernest in town, and Jack in the country?
  • quite the sort of thing one tells to a nice, sweet, refined girl. What
  • extraordinary ideas you have about the way to behave to a woman!
  • she is pretty, and to some one else, if she is plain.
  • say he died in Paris of apoplexy. Lots of people die of apoplexy, quite
  • suddenly, don't they?
  • thing that runs in families. You had much better say a severe chill.
  • kind?
  • in Paris, by a severe chill. That gets rid of him.
  • much interested in your poor brother Ernest? Won't she feel his loss a
  • good deal?
  • glad to say. She has got a capital appetite, goes long walks, and pays
  • no attention at all to her lessons.
  • pretty, and she is only just eighteen.
  • pretty ward who is only just eighteen?
  • Gwendolen are perfectly certain to be extremely great friends. I'll bet
  • you anything you like that half an hour after they have met, they will be
  • calling each other sister.
  • other things first. Now, my dear boy, if we want to get a good table at
  • Willis's, we really must go and dress. Do you know it is nearly seven?
  • hard work where there is no definite object of any kind.
  • [Enter Lane.]
  • [Enter Gwendolen. Lane goes out.]
  • particular to say to Mr. Worthing.
  • life. You are not quite old enough to do that. [Algernon retires to the
  • fireplace.]
  • mamma's face I fear we never shall. Few parents nowadays pay any regard
  • to what their children say to them. The old-fashioned respect for the
  • young is fast dying out. Whatever influence I ever had over mamma, I
  • lost at the age of three. But although she may prevent us from becoming
  • man and wife, and I may marry some one else, and marry often, nothing
  • that she can possibly do can alter my eternal devotion to you.
  • with unpleasing comments, has naturally stirred the deeper fibres of my
  • nature. Your Christian name has an irresistible fascination. The
  • simplicity of your character makes you exquisitely incomprehensible to
  • me. Your town address at the Albany I have. What is your address in the
  • country?
  • [Algernon, who has been carefully listening, smiles to himself, and
  • writes the address on his shirt-cuff. Then picks up the Railway Guide.]
  • necessary to do something desperate. That of course will require serious
  • consideration. I will communicate with you daily.
  • [Lane presents several letters on a salver to Algernon. It is to be
  • surmised that they are bills, as Algernon, after looking at the
  • envelopes, tears them up.]
  • dress clothes, my smoking jacket, and all the Bunbury suits . . .
  • [Enter Jack. Lane goes off.]
  • for in my life. [Algernon is laughing immoderately.] What on earth are
  • you so amused at?
  • serious scrape some day.
  • serious.
  • [Jack looks indignantly at him, and leaves the room. Algernon lights a
  • cigarette, reads his shirt-cuff, and smiles.]
  • ACT DROP
  • SECOND ACT
  • SCENE
  • Garden at the Manor House. A flight of grey stone steps leads up to the
  • house. The garden, an old-fashioned one, full of roses. Time of year,
  • July. Basket chairs, and a table covered with books, are set under a
  • large yew-tree.
  • [Miss Prism discovered seated at the table. Cecily is at the back
  • watering flowers.]
  • occupation as the watering of flowers is rather Moulton's duty than
  • yours? Especially at a moment when intellectual pleasures await you.
  • Your German grammar is on the table. Pray open it at page fifteen. We
  • will repeat yesterday's lesson.
  • at all a becoming language. I know perfectly well that I look quite
  • plain after my German lesson.
  • improve yourself in every way. He laid particular stress on your German,
  • as he was leaving for town yesterday. Indeed, he always lays stress on
  • your German when he is leaving for town.
  • that I think he cannot be quite well.
  • health, and his gravity of demeanour is especially to be commended in one
  • so comparatively young as he is. I know no one who has a higher sense of
  • duty and responsibility.
  • three are together.
  • troubles in his life. Idle merriment and triviality would be out of
  • place in his conversation. You must remember his constant anxiety about
  • that unfortunate young man his brother.
  • brother, to come down here sometimes. We might have a good influence
  • over him, Miss Prism. I am sure you certainly would. You know German,
  • and geology, and things of that kind influence a man very much. [Cecily
  • begins to write in her diary.]
  • produce any effect on a character that according to his own brother's
  • admission is irretrievably weak and vacillating. Indeed I am not sure
  • that I would desire to reclaim him. I am not in favour of this modern
  • mania for turning bad people into good people at a moment's notice. As a
  • man sows so let him reap. You must put away your diary, Cecily. I
  • really don't see why you should keep a diary at all.
  • life. If I didn't write them down, I should probably forget all about
  • them.
  • with us.
  • happened, and couldn't possibly have happened. I believe that Memory is
  • responsible for nearly all the three-volume novels that Mudie sends us.
  • I wrote one myself in earlier days.
  • hope it did not end happily? I don't like novels that end happily. They
  • depress me so much.
  • Fiction means.
  • ever published?
  • [Cecily starts.] I use the word in the sense of lost or mislaid. To
  • your work, child, these speculations are profitless.
  • garden.
  • pleasure.
  • [Enter Canon Chasuble.]
  • well?
  • think it would do her so much good to have a short stroll with you in the
  • Park, Dr. Chasuble.
  • you had a headache. Indeed I was thinking about that, and not about my
  • German lesson, when the Rector came in.
  • pupil, I would hang upon her lips. [Miss Prism glares.] I spoke
  • metaphorically.--My metaphor was drawn from bees. Ahem! Mr. Worthing, I
  • suppose, has not returned from town yet?
  • not one of those whose sole aim is enjoyment, as, by all accounts, that
  • unfortunate young man his brother seems to be. But I must not disturb
  • Egeria and her pupil any longer.
  • authors. I shall see you both no doubt at Evensong?
  • I have a headache after all, and a walk might do it good.
  • as the schools and back.
  • Political Economy in my absence. The chapter on the Fall of the Rupee
  • you may omit. It is somewhat too sensational. Even these metallic
  • problems have their melodramatic side.
  • [Goes down the garden with Dr. Chasuble.]
  • Political Economy! Horrid Geography! Horrid, horrid German!
  • [Enter Merriman with a card on a salver.]
  • has brought his luggage with him.
  • Albany, W.' Uncle Jack's brother! Did you tell him Mr. Worthing was in
  • town?
  • that you and Miss Prism were in the garden. He said he was anxious to
  • speak to you privately for a moment.
  • talk to the housekeeper about a room for him.
  • [Merriman goes off.]
  • frightened. I am so afraid he will look just like every one else.
  • [Enter Algernon, very gay and debonnair.] He does!
  • I believe I am more than usually tall for my age. [Algernon is rather
  • taken aback.] But I am your cousin Cecily. You, I see from your card,
  • are Uncle Jack's brother, my cousin Ernest, my wicked cousin Ernest.
  • think that I am wicked.
  • a very inexcusable manner. I hope you have not been leading a double
  • life, pretending to be wicked and being really good all the time. That
  • would be hypocrisy.
  • rather reckless.
  • my own small way.
  • it must have been very pleasant.
  • back till Monday afternoon.
  • first train on Monday morning. I have a business appointment that I am
  • anxious . . . to miss?
  • business engagement, if one wants to retain any sense of the beauty of
  • life, but still I think you had better wait till Uncle Jack arrives. I
  • know he wants to speak to you about your emigrating.
  • in neckties at all.
  • you to Australia.
  • to choose between this world, the next world, and Australia.
  • next world, are not particularly encouraging. This world is good enough
  • for me, cousin Cecily.
  • You might make that your mission, if you don't mind, cousin Cecily.
  • is going to lead an entirely new life, one requires regular and wholesome
  • meals. Won't you come in?
  • appetite unless I have a buttonhole first.
  • Miss Prism never says such things to me.
  • rose in his buttonhole.] You are the prettiest girl I ever saw.
  • caught in.
  • shouldn't know what to talk to him about.
  • [They pass into the house. Miss Prism and Dr. Chasuble return.]
  • married. A misanthrope I can understand--a womanthrope, never!
  • neologistic a phrase. The precept as well as the practice of the
  • Primitive Church was distinctly against matrimony.
  • Primitive Church has not lasted up to the present day. And you do not
  • seem to realise, dear Doctor, that by persistently remaining single, a
  • man converts himself into a permanent public temptation. Men should be
  • more careful; this very celibacy leads weaker vessels astray.
  • Maturity can always be depended on. Ripeness can be trusted. Young
  • women are green. [Dr. Chasuble starts.] I spoke horticulturally. My
  • metaphor was drawn from fruits. But where is Cecily?
  • [Enter Jack slowly from the back of the garden. He is dressed in the
  • deepest mourning, with crape hatband and black gloves.]
  • Monday afternoon.
  • sooner than I expected. Dr. Chasuble, I hope you are well?
  • some terrible calamity?
  • least the consolation of knowing that you were always the most generous
  • and forgiving of brothers.
  • night from the manager of the Grand Hotel.
  • of us are perfect. I myself am peculiarly susceptible to draughts. Will
  • the interment take place here?
  • any very serious state of mind at the last. You would no doubt wish me
  • to make some slight allusion to this tragic domestic affliction next
  • Sunday. [Jack presses his hand convulsively.] My sermon on the meaning
  • of the manna in the wilderness can be adapted to almost any occasion,
  • joyful, or, as in the present case, distressing. [All sigh.] I have
  • preached it at harvest celebrations, christenings, confirmations, on days
  • of humiliation and festal days. The last time I delivered it was in the
  • Cathedral, as a charity sermon on behalf of the Society for the
  • Prevention of Discontent among the Upper Orders. The Bishop, who was
  • present, was much struck by some of the analogies I drew.
  • Chasuble? I suppose you know how to christen all right? [Dr. Chasuble
  • looks astounded.] I mean, of course, you are continually christening,
  • aren't you?
  • duties in this parish. I have often spoken to the poorer classes on the
  • subject. But they don't seem to know what thrift is.
  • Mr. Worthing? Your brother was, I believe, unmarried, was he not?
  • are.
  • children. No! the fact is, I would like to be christened myself, this
  • afternoon, if you have nothing better to do.
  • would bother you in any way, or if you think I am a little too old now.
  • adults is a perfectly canonical practice.
  • necessary, or indeed I think advisable. Our weather is so changeable. At
  • what hour would you wish the ceremony performed?
  • to perform at that time. A case of twins that occurred recently in one
  • of the outlying cottages on your own estate. Poor Jenkins the carter, a
  • most hard-working man.
  • babies. It would be childish. Would half-past five do?
  • Worthing, I will not intrude any longer into a house of sorrow. I would
  • merely beg you not to be too much bowed down by grief. What seem to us
  • bitter trials are often blessings in disguise.
  • [Enter Cecily from the house.]
  • clothes you have got on! Do go and change them.
  • brow in a melancholy manner.]
  • you had toothache, and I have got such a surprise for you. Who do you
  • think is in the dining-room? Your brother!
  • the past he is still your brother. You couldn't be so heartless as to
  • disown him. I'll tell him to come out. And you will shake hands with
  • him, won't you, Uncle Jack? [Runs back into the house.]
  • return seems to me peculiarly distressing.
  • I think it is perfectly absurd.
  • [Enter Algernon and Cecily hand in hand. They come slowly up to Jack.]
  • very sorry for all the trouble I have given you, and that I intend to
  • lead a better life in the future. [Jack glares at him and does not take
  • his hand.]
  • here disgraceful. He knows perfectly well why.
  • has just been telling me about his poor invalid friend Mr. Bunbury whom
  • he goes to visit so often. And surely there must be much good in one who
  • is kind to an invalid, and leaves the pleasures of London to sit by a bed
  • of pain.
  • state of health.
  • about anything else. It is enough to drive one perfectly frantic.
  • must say that I think that Brother John's coldness to me is peculiarly
  • painful. I expected a more enthusiastic welcome, especially considering
  • it is the first time I have come here.
  • forgive you.
  • Algernon and glares.]
  • I think we might leave the two brothers together.
  • over.
  • as possible. I don't allow any Bunburying here.
  • [Enter Merriman.]
  • I suppose that is all right?
  • the room next to your own.
  • and a large luncheon-basket.
  • suddenly called back to town.
  • back to town at all.
  • in the smallest degree.
  • ridiculous in them. Why on earth don't you go up and change? It is
  • perfectly childish to be in deep mourning for a man who is actually
  • staying for a whole week with you in your house as a guest. I call it
  • grotesque.
  • or anything else. You have got to leave . . . by the four-five train.
  • would be most unfriendly. If I were in mourning you would stay with me,
  • I suppose. I should think it very unkind if you didn't.
  • long to dress, and with such little result.
  • as you are.
  • by being always immensely over-educated.
  • presence in my garden utterly absurd. However, you have got to catch the
  • four-five, and I hope you will have a pleasant journey back to town. This
  • Bunburying, as you call it, has not been a great success for you.
  • [Goes into the house.]
  • and that is everything.
  • [Enter Cecily at the back of the garden. She picks up the can and begins
  • to water the flowers.] But I must see her before I go, and make
  • arrangements for another Bunbury. Ah, there she is.
  • with Uncle Jack.
  • a very brief space of time. The absence of old friends one can endure
  • with equanimity. But even a momentary separation from anyone to whom one
  • has just been introduced is almost unbearable.
  • [Enter Merriman.]
  • at Cecily.]
  • frankly and openly that you seem to me to be in every way the visible
  • personification of absolute perfection.
  • will allow me, I will copy your remarks into my diary. [Goes over to
  • table and begins writing in diary.]
  • May I?
  • young girl's record of her own thoughts and impressions, and consequently
  • meant for publication. When it appears in volume form I hope you will
  • order a copy. But pray, Ernest, don't stop. I delight in taking down
  • from dictation. I have reached 'absolute perfection'. You can go on. I
  • am quite ready for more.
  • fluently and not cough. Besides, I don't know how to spell a cough.
  • [Writes as Algernon speaks.]
  • upon your wonderful and incomparable beauty, I have dared to love you
  • wildly, passionately, devotedly, hopelessly.
  • passionately, devotedly, hopelessly. Hopelessly doesn't seem to make
  • much sense, does it?
  • [Enter Merriman.]
  • [Merriman retires.]
  • staying on till next week, at the same hour.
  • whole world but you. I love you, Cecily. You will marry me, won't you?
  • last three months.
  • had a younger brother who was very wicked and bad, you of course have
  • formed the chief topic of conversation between myself and Miss Prism. And
  • of course a man who is much talked about is always very attractive. One
  • feels there must be something in him, after all. I daresay it was
  • foolish of me, but I fell in love with you, Ernest.
  • of my existence, I determined to end the matter one way or the other, and
  • after a long struggle with myself I accepted you under this dear old tree
  • here. The next day I bought this little ring in your name, and this is
  • the little bangle with the true lover's knot I promised you always to
  • wear.
  • I've always given for your leading such a bad life. And this is the box
  • in which I keep all your dear letters. [Kneels at table, opens box, and
  • produces letters tied up with blue ribbon.]
  • you any letters.
  • well that I was forced to write your letters for you. I wrote always
  • three times a week, and sometimes oftener.
  • [Replaces box.] The three you wrote me after I had broken off the
  • engagement are so beautiful, and so badly spelled, that even now I can
  • hardly read them without crying a little.
  • entry if you like. [Shows diary.] 'To-day I broke off my engagement with
  • Ernest. I feel it is better to do so. The weather still continues
  • charming.'
  • had done nothing at all. Cecily, I am very much hurt indeed to hear you
  • broke it off. Particularly when the weather was so charming.
  • hadn't been broken off at least once. But I forgave you before the week
  • was out.
  • are, Cecily.
  • through his hair.] I hope your hair curls naturally, does it?
  • you. Besides, of course, there is the question of your name.
  • girlish dream of mine to love some one whose name was Ernest. [Algernon
  • rises, Cecily also.] There is something in that name that seems to
  • inspire absolute confidence. I pity any poor married woman whose husband
  • is not called Ernest.
  • if I had some other name?
  • can't see why you should object to the name of Algernon. It is not at
  • all a bad name. In fact, it is rather an aristocratic name. Half of the
  • chaps who get into the Bankruptcy Court are called Algernon. But
  • seriously, Cecily . . . [Moving to her] . . . if my name was Algy,
  • couldn't you love me?
  • character, but I fear that I should not be able to give you my undivided
  • attention.
  • suppose, thoroughly experienced in the practice of all the rites and
  • ceremonials of the Church?
  • written a single book, so you can imagine how much he knows.
  • on most important business.
  • and that I only met you to-day for the first time, I think it is rather
  • hard that you should leave me for so long a period as half an hour.
  • Couldn't you make it twenty minutes?
  • [Kisses her and rushes down the garden.]
  • enter his proposal in my diary.
  • [Enter Merriman.]
  • important business, Miss Fairfax states.
  • time ago.
  • back soon. And you can bring tea.
  • are associated with Uncle Jack in some of his philanthropic work in
  • London. I don't quite like women who are interested in philanthropic
  • work. I think it is so forward of them.
  • [Enter Merriman.]
  • [Enter Gwendolen.]
  • [Exit Merriman.]
  • My name is Cecily Cardew.
  • very sweet name! Something tells me that we are going to be great
  • friends. I like you already more than I can say. My first impressions
  • of people are never wrong.
  • other such a comparatively short time. Pray sit down.
  • mentioning who I am. My father is Lord Bracknell. You have never heard
  • of papa, I suppose?
  • entirely unknown. I think that is quite as it should be. The home seems
  • to me to be the proper sphere for the man. And certainly once a man
  • begins to neglect his domestic duties he becomes painfully effeminate,
  • does he not? And I don't like that. It makes men so very attractive.
  • Cecily, mamma, whose views on education are remarkably strict, has
  • brought me up to be extremely short-sighted; it is part of her system; so
  • do you mind my looking at you through my glasses?
  • are here on a short visit, I suppose.
  • relative of advanced years, resides here also?
  • arduous task of looking after me.
  • ward. How secretive of him! He grows more interesting hourly. I am not
  • sure, however, that the news inspires me with feelings of unmixed
  • delight. [Rising and going to her.] I am very fond of you, Cecily; I
  • have liked you ever since I met you! But I am bound to state that now
  • that I know that you are Mr. Worthing's ward, I cannot help expressing a
  • wish you were--well, just a little older than you seem to be--and not
  • quite so very alluring in appearance. In fact, if I may speak candidly--
  • say, one should always be quite candid.
  • were fully forty-two, and more than usually plain for your age. Ernest
  • has a strong upright nature. He is the very soul of truth and honour.
  • Disloyalty would be as impossible to him as deception. But even men of
  • the noblest possible moral character are extremely susceptible to the
  • influence of the physical charms of others. Modern, no less than Ancient
  • History, supplies us with many most painful examples of what I refer to.
  • If it were not so, indeed, History would be quite unreadable.
  • his brother--his elder brother.
  • had a brother.
  • time.
  • never heard any man mention his brother. The subject seems distasteful
  • to most men. Cecily, you have lifted a load from my mind. I was growing
  • almost anxious. It would have been terrible if any cloud had come across
  • a friendship like ours, would it not? Of course you are quite, quite
  • sure that it is not Mr. Ernest Worthing who is your guardian?
  • reason why I should make a secret of it to you. Our little county
  • newspaper is sure to chronicle the fact next week. Mr. Ernest Worthing
  • and I are engaged to be married.
  • must be some slight error. Mr. Ernest Worthing is engaged to me. The
  • announcement will appear in the _Morning Post_ on Saturday at the latest.
  • misconception. Ernest proposed to me exactly ten minutes ago. [Shows
  • diary.]
  • certainly very curious, for he asked me to be his wife yesterday
  • afternoon at 5.30. If you would care to verify the incident, pray do so.
  • [Produces diary of her own.] I never travel without my diary. One
  • should always have something sensational to read in the train. I am so
  • sorry, dear Cecily, if it is any disappointment to you, but I am afraid I
  • have the prior claim.
  • if it caused you any mental or physical anguish, but I feel bound to
  • point out that since Ernest proposed to you he clearly has changed his
  • mind.
  • any foolish promise I shall consider it my duty to rescue him at once,
  • and with a firm hand.
  • dear boy may have got into, I will never reproach him with it after we
  • are married.
  • are presumptuous. On an occasion of this kind it becomes more than a
  • moral duty to speak one's mind. It becomes a pleasure.
  • engagement? How dare you? This is no time for wearing the shallow mask
  • of manners. When I see a spade I call it a spade.
  • spade. It is obvious that our social spheres have been widely different.
  • [Enter Merriman, followed by the footman. He carries a salver, table
  • cloth, and plate stand. Cecily is about to retort. The presence of the
  • servants exercises a restraining influence, under which both girls
  • chafe.]
  • clear table and lay cloth. A long pause. Cecily and Gwendolen glare at
  • each other.]
  • Cardew?
  • close one can see five counties.
  • crowds.
  • bites her lip, and beats her foot nervously with her parasol.]
  • Cardew.
  • London.
  • in the country, if anybody who is anybody does. The country always bores
  • me to death.
  • is it not? I believe the aristocracy are suffering very much from it
  • just at present. It is almost an epidemic amongst them, I have been
  • told. May I offer you some tea, Miss Fairfax?
  • girl! But I require tea!
  • any more. [Cecily looks angrily at her, takes up the tongs and puts four
  • lumps of sugar into the cup.]
  • rarely seen at the best houses nowadays.
  • that to Miss Fairfax.
  • [Merriman does so, and goes out with footman. Gwendolen drinks the tea
  • and makes a grimace. Puts down cup at once, reaches out her hand to the
  • bread and butter, looks at it, and finds it is cake. Rises in
  • indignation.]
  • asked most distinctly for bread and butter, you have given me cake. I am
  • known for the gentleness of my disposition, and the extraordinary
  • sweetness of my nature, but I warn you, Miss Cardew, you may go too far.
  • machinations of any other girl there are no lengths to which I would not
  • go.
  • were false and deceitful. I am never deceived in such matters. My first
  • impressions of people are invariably right.
  • valuable time. No doubt you have many other calls of a similar character
  • to make in the neighbourhood.
  • [Enter Jack.]
  • married to this young lady? [Points to Cecily.]
  • have put such an idea into your pretty little head?
  • Miss Fairfax. The gentleman whose arm is at present round your waist is
  • my guardian, Mr. John Worthing.
  • [Enter Algernon.]
  • My own love! [Offers to kiss her.]
  • engaged to be married to this young lady?
  • Gwendolen!
  • into your pretty little head?
  • [Algernon kisses her.]
  • gentleman who is now embracing you is my cousin, Mr. Algernon Moncrieff.
  • two girls move towards each other and put their arms round each other's
  • waists as if for protection.]
  • deny anything if I liked. But my name certainly is John. It has been
  • John for years.
  • us.
  • not? [They embrace. Jack and Algernon groan and walk up and down.]
  • be allowed to ask my guardian.
  • I would like to be permitted to put to you. Where is your brother
  • Ernest? We are both engaged to be married to your brother Ernest, so it
  • is a matter of some importance to us to know where your brother Ernest is
  • at present.
  • for me to be forced to speak the truth. It is the first time in my life
  • that I have ever been reduced to such a painful position, and I am really
  • quite inexperienced in doing anything of the kind. However, I will tell
  • you quite frankly that I have no brother Ernest. I have no brother at
  • all. I never had a brother in my life, and I certainly have not the
  • smallest intention of ever having one in the future.
  • engaged to be married to any one.
  • find herself in. Is it?
  • after us there.
  • [They retire into the house with scornful looks.]
  • suppose?
  • wonderful Bunbury I have ever had in my life.
  • chooses. Every serious Bunburyist knows that.
  • have any amusement in life. I happen to be serious about Bunburying.
  • What on earth you are serious about I haven't got the remotest idea.
  • About everything, I should fancy. You have such an absolutely trivial
  • nature.
  • wretched business is that your friend Bunbury is quite exploded. You
  • won't be able to run down to the country quite so often as you used to
  • do, dear Algy. And a very good thing too.
  • won't be able to disappear to London quite so frequently as your wicked
  • custom was. And not a bad thing either.
  • taking in a sweet, simple, innocent girl like that is quite inexcusable.
  • To say nothing of the fact that she is my ward.
  • brilliant, clever, thoroughly experienced young lady like Miss Fairfax.
  • To say nothing of the fact that she is my cousin.
  • Fairfax being united.
  • eat muffins.] It is very vulgar to talk about one's business. Only
  • people like stock-brokers do that, and then merely at dinner parties.
  • horrible trouble, I can't make out. You seem to me to be perfectly
  • heartless.
  • would probably get on my cuffs. One should always eat muffins quite
  • calmly. It is the only way to eat them.
  • the circumstances.
  • me. Indeed, when I am in really great trouble, as any one who knows me
  • intimately will tell you, I refuse everything except food and drink. At
  • the present moment I am eating muffins because I am unhappy. Besides, I
  • am particularly fond of muffins. [Rising.]
  • that greedy way. [Takes muffins from Algernon.]
  • I don't like tea-cake.
  • garden.
  • muffins.
  • That is a very different thing.
  • muffin-dish from Jack.]
  • It's absurd. I never go without my dinner. No one ever does, except
  • vegetarians and people like that. Besides I have just made arrangements
  • with Dr. Chasuble to be christened at a quarter to six under the name of
  • Ernest.
  • made arrangements this morning with Dr. Chasuble to be christened myself
  • at 5.30, and I naturally will take the name of Ernest. Gwendolen would
  • wish it. We can't both be christened Ernest. It's absurd. Besides, I
  • have a perfect right to be christened if I like. There is no evidence at
  • all that I have ever been christened by anybody. I should think it
  • extremely probable I never was, and so does Dr. Chasuble. It is entirely
  • different in your case. You have been christened already.
  • not quite sure about your ever having been christened, I must say I think
  • it rather dangerous your venturing on it now. It might make you very
  • unwell. You can hardly have forgotten that some one very closely
  • connected with you was very nearly carried off this week in Paris by a
  • severe chill.
  • always making wonderful improvements in things.
  • always talking nonsense.
  • There are only two left. [Takes them.] I told you I was particularly
  • fond of muffins.
  • your guests? What ideas you have of hospitality!
  • Why don't you go!
  • muffin left. [Jack groans, and sinks into a chair. Algernon still
  • continues eating.]
  • ACT DROP
  • THIRD ACT
  • SCENE
  • Morning-room at the Manor House.
  • [Gwendolen and Cecily are at the window, looking out into the garden.]
  • as any one else would have done, seems to me to show that they have some
  • sense of shame left.
  • Couldn't you cough?
  • by Algernon. They whistle some dreadful popular air from a British
  • Opera.]
  • Much depends on your reply.
  • kindly answer me the following question. Why did you pretend to be my
  • guardian's brother?
  • explanation, does it not?
  • answer.
  • is the vital thing. Mr. Worthing, what explanation can you offer to me
  • for pretending to have a brother? Was it in order that you might have an
  • opportunity of coming up to town to see me as often as possible?
  • crush them. This is not the moment for German scepticism. [Moving to
  • Mr. Worthing's. That seems to me to have the stamp of truth upon it.
  • alone inspires one with absolute credulity.
  • one cannot surrender. Which of us should tell them? The task is not a
  • pleasant one.
  • other people. Will you take the time from me?
  • Gwendolen and Cecily [Speaking together.] Your Christian names are still
  • an insuperable barrier. That is all!
  • Jack and Algernon [Speaking together.] Our Christian names! Is that
  • all? But we are going to be christened this afternoon.
  • thing?
  • ordeal?
  • questions of self-sacrifice are concerned, men are infinitely beyond us.
  • absolutely nothing.
  • [Enter Merriman. When he enters he coughs loudly, seeing the situation.]
  • [Enter Lady Bracknell. The couples separate in alarm. Exit Merriman.]
  • mamma.
  • of any kind is a sign of mental decay in the young, of physical weakness
  • in the old. [Turns to Jack.] Apprised, sir, of my daughter's sudden
  • flight by her trusty maid, whose confidence I purchased by means of a
  • small coin, I followed her at once by a luggage train. Her unhappy
  • father is, I am glad to say, under the impression that she is attending a
  • more than usually lengthy lecture by the University Extension Scheme on
  • the Influence of a permanent income on Thought. I do not propose to
  • undeceive him. Indeed I have never undeceived him on any question. I
  • would consider it wrong. But of course, you will clearly understand that
  • all communication between yourself and my daughter must cease immediately
  • from this moment. On this point, as indeed on all points, I am firm.
  • Algernon! . . . Algernon!
  • friend Mr. Bunbury resides?
  • is somewhere else at present. In fact, Bunbury is dead.
  • been extremely sudden.
  • Bunbury died this afternoon.
  • I was not aware that Mr. Bunbury was interested in social legislation. If
  • so, he is well punished for his morbidity.
  • found out that Bunbury could not live, that is what I mean--so Bunbury
  • died.
  • his physicians. I am glad, however, that he made up his mind at the last
  • to some definite course of action, and acted under proper medical advice.
  • And now that we have finally got rid of this Mr. Bunbury, may I ask, Mr.
  • Worthing, who is that young person whose hand my nephew Algernon is now
  • holding in what seems to me a peculiarly unnecessary manner?
  • coldly to Cecily.]
  • I do not know whether there is anything peculiarly exciting in the air of
  • this particular part of Hertfordshire, but the number of engagements that
  • go on seems to me considerably above the proper average that statistics
  • have laid down for our guidance. I think some preliminary inquiry on my
  • part would not be out of place. Mr. Worthing, is Miss Cardew at all
  • connected with any of the larger railway stations in London? I merely
  • desire information. Until yesterday I had no idea that there were any
  • families or persons whose origin was a Terminus. [Jack looks perfectly
  • furious, but restrains himself.]
  • the late Mr. Thomas Cardew of 149 Belgrave Square, S.W.; Gervase Park,
  • Dorking, Surrey; and the Sporran, Fifeshire, N.B.
  • inspire confidence, even in tradesmen. But what proof have I of their
  • authenticity?
  • are open to your inspection, Lady Bracknell.
  • publication.
  • Markby.
  • position in their profession. Indeed I am told that one of the Mr.
  • Markby's is occasionally to be seen at dinner parties. So far I am
  • satisfied.
  • have also in my possession, you will be pleased to hear, certificates of
  • Miss Cardew's birth, baptism, whooping cough, registration, vaccination,
  • confirmation, and the measles; both the German and the English variety.
  • somewhat too exciting for a young girl. I am not myself in favour of
  • premature experiences. [Rises, looks at her watch.] Gwendolen! the time
  • approaches for our departure. We have not a moment to lose. As a matter
  • of form, Mr. Worthing, I had better ask you if Miss Cardew has any little
  • fortune?
  • is all. Goodbye, Lady Bracknell. So pleased to have seen you.
  • hundred and thirty thousand pounds! And in the Funds! Miss Cardew seems
  • to me a most attractive young lady, now that I look at her. Few girls of
  • the present day have any really solid qualities, any of the qualities
  • that last, and improve with time. We live, I regret to say, in an age of
  • surfaces. [To Cecily.] Come over here, dear. [Cecily goes across.]
  • Pretty child! your dress is sadly simple, and your hair seems almost as
  • Nature might have left it. But we can soon alter all that. A thoroughly
  • experienced French maid produces a really marvellous result in a very
  • brief space of time. I remember recommending one to young Lady Lancing,
  • and after three months her own husband did not know her.
  • practised smile, to Cecily.] Kindly turn round, sweet child. [Cecily
  • turns completely round.] No, the side view is what I want. [Cecily
  • presents her profile.] Yes, quite as I expected. There are distinct
  • social possibilities in your profile. The two weak points in our age are
  • its want of principle and its want of profile. The chin a little higher,
  • dear. Style largely depends on the way the chin is worn. They are worn
  • very high, just at present. Algernon!
  • profile.
  • world. And I don't care twopence about social possibilities.
  • people who can't get into it do that. [To Cecily.] Dear child, of
  • course you know that Algernon has nothing but his debts to depend upon.
  • But I do not approve of mercenary marriages. When I married Lord
  • Bracknell I had no fortune of any kind. But I never dreamed for a moment
  • of allowing that to stand in my way. Well, I suppose I must give my
  • consent.
  • engagements. They give people the opportunity of finding out each
  • other's character before marriage, which I think is never advisable.
  • engagement is quite out of the question. I am Miss Cardew's guardian,
  • and she cannot marry without my consent until she comes of age. That
  • consent I absolutely decline to give.
  • I may almost say an ostentatiously, eligible young man. He has nothing,
  • but he looks everything. What more can one desire?
  • Bracknell, about your nephew, but the fact is that I do not approve at
  • all of his moral character. I suspect him of being untruthful. [Algernon
  • and Cecily look at him in indignant amazement.]
  • Oxonian.
  • afternoon during my temporary absence in London on an important question
  • of romance, he obtained admission to my house by means of the false
  • pretence of being my brother. Under an assumed name he drank, I've just
  • been informed by my butler, an entire pint bottle of my Perrier-Jouet,
  • Brut, '89; wine I was specially reserving for myself. Continuing his
  • disgraceful deception, he succeeded in the course of the afternoon in
  • alienating the affections of my only ward. He subsequently stayed to
  • tea, and devoured every single muffin. And what makes his conduct all
  • the more heartless is, that he was perfectly well aware from the first
  • that I have no brother, that I never had a brother, and that I don't
  • intend to have a brother, not even of any kind. I distinctly told him so
  • myself yesterday afternoon.
  • decided entirely to overlook my nephew's conduct to you.
  • however, is unalterable. I decline to give my consent.
  • over.] How old are you, dear?
  • when I go to evening parties.
  • alteration. Indeed, no woman should ever be quite accurate about her
  • age. It looks so calculating . . . [In a meditative manner.] Eighteen,
  • but admitting to twenty at evening parties. Well, it will not be very
  • long before you are of age and free from the restraints of tutelage. So
  • I don't think your guardian's consent is, after all, a matter of any
  • importance.
  • is only fair to tell you that according to the terms of her grandfather's
  • will Miss Cardew does not come legally of age till she is thirty-five.
  • five is a very attractive age. London society is full of women of the
  • very highest birth who have, of their own free choice, remained thirty-
  • five for years. Lady Dumbleton is an instance in point. To my own
  • knowledge she has been thirty-five ever since she arrived at the age of
  • forty, which was many years ago now. I see no reason why our dear Cecily
  • should not be even still more attractive at the age you mention than she
  • is at present. There will be a large accumulation of property.
  • I hate waiting even five minutes for anybody. It always makes me rather
  • cross. I am not punctual myself, I know, but I do like punctuality in
  • others, and waiting, even to be married, is quite out of the question.
  • that she cannot wait till she is thirty-five--a remark which I am bound
  • to say seems to me to show a somewhat impatient nature--I would beg of
  • you to reconsider your decision.
  • hands. The moment you consent to my marriage with Gwendolen, I will most
  • gladly allow your nephew to form an alliance with my ward.
  • aware that what you propose is out of the question.
  • to.
  • Algernon, of course, can choose for himself. [Pulls out her watch.]
  • Come, dear, [Gwendolen rises] we have already missed five, if not six,
  • trains. To miss any more might expose us to comment on the platform.
  • [Enter Dr. Chasuble.]
  • Both these gentlemen have expressed a desire for immediate baptism.
  • Algernon, I forbid you to be baptized. I will not hear of such excesses.
  • Lord Bracknell would be highly displeased if he learned that that was the
  • way in which you wasted your time and money.
  • at all this afternoon?
  • practical value to either of us, Dr. Chasuble.
  • They savour of the heretical views of the Anabaptists, views that I have
  • completely refuted in four of my unpublished sermons. However, as your
  • present mood seems to be one peculiarly secular, I will return to the
  • church at once. Indeed, I have just been informed by the pew-opener that
  • for the last hour and a half Miss Prism has been waiting for me in the
  • vestry.
  • Prism?
  • may prove to be one of vital importance to Lord Bracknell and myself. Is
  • this Miss Prism a female of repellent aspect, remotely connected with
  • education?
  • and the very picture of respectability.
  • position she holds in your household?
  • three years Miss Cardew's esteemed governess and valued companion.
  • Let her be sent for.
  • [Enter Miss Prism hurriedly.]
  • have been waiting for you there for an hour and three-quarters. [Catches
  • sight of Lady Bracknell, who has fixed her with a stony glare. Miss
  • Prism grows pale and quails. She looks anxiously round as if desirous to
  • escape.]
  • her head in shame.] Come here, Prism! [Miss Prism approaches in a
  • humble manner.] Prism! Where is that baby? [General consternation. The
  • Canon starts back in horror. Algernon and Jack pretend to be anxious to
  • shield Cecily and Gwendolen from hearing the details of a terrible public
  • scandal.] Twenty-eight years ago, Prism, you left Lord Bracknell's
  • house, Number 104, Upper Grosvenor Street, in charge of a perambulator
  • that contained a baby of the male sex. You never returned. A few weeks
  • later, through the elaborate investigations of the Metropolitan police,
  • the perambulator was discovered at midnight, standing by itself in a
  • remote corner of Bayswater. It contained the manuscript of a
  • three-volume novel of more than usually revolting sentimentality. [Miss
  • Prism starts in involuntary indignation.] But the baby was not there!
  • [Every one looks at Miss Prism.] Prism! Where is that baby? [A pause.]
  • only wish I did. The plain facts of the case are these. On the morning
  • of the day you mention, a day that is for ever branded on my memory, I
  • prepared as usual to take the baby out in its perambulator. I had also
  • with me a somewhat old, but capacious hand-bag in which I had intended to
  • place the manuscript of a work of fiction that I had written during my
  • few unoccupied hours. In a moment of mental abstraction, for which I
  • never can forgive myself, I deposited the manuscript in the basinette,
  • and placed the baby in the hand-bag.
  • the hand-bag?
  • insist on knowing where you deposited the hand-bag that contained that
  • infant.
  • stations in London.
  • a chair.]
  • me.
  • life. [Exit Jack in great excitement.]
  • tell you that in families of high position strange coincidences are not
  • supposed to occur. They are hardly considered the thing.
  • [Noises heard overhead as if some one was throwing trunks about. Every
  • one looks up.]
  • was having an argument. I dislike arguments of any kind. They are
  • always vulgar, and often convincing.
  • with a hand-bag of black leather in his hand.]
  • Examine it carefully before you speak. The happiness of more than one
  • life depends on your answer.
  • received through the upsetting of a Gower Street omnibus in younger and
  • happier days. Here is the stain on the lining caused by the explosion of
  • a temperance beverage, an incident that occurred at Leamington. And
  • here, on the lock, are my initials. I had forgotten that in an
  • extravagant mood I had had them placed there. The bag is undoubtedly
  • mine. I am delighted to have it so unexpectedly restored to me. It has
  • been a great inconvenience being without it all these years.
  • this hand-bag. I was the baby you placed in it.
  • unmarried!
  • who has the right to cast a stone against one who has suffered? Cannot
  • repentance wipe out an act of folly? Why should there be one law for
  • men, and another for women? Mother, I forgive you. [Tries to embrace
  • her again.]
  • [Pointing to Lady Bracknell.] There is the lady who can tell you who you
  • really are.
  • would you kindly inform me who I am?
  • altogether please you. You are the son of my poor sister, Mrs.
  • Moncrieff, and consequently Algernon's elder brother.
  • had a brother! I always said I had a brother! Cecily,--how could you
  • have ever doubted that I had a brother? [Seizes hold of Algernon.] Dr.
  • Chasuble, my unfortunate brother. Miss Prism, my unfortunate brother.
  • Gwendolen, my unfortunate brother. Algy, you young scoundrel, you will
  • have to treat me with more respect in the future. You have never behaved
  • to me like a brother in all your life.
  • however, though I was out of practice.
  • [Shakes hands.]
  • Christian name, now that you have become some one else?
  • decision on the subject of my name is irrevocable, I suppose?
  • a moment. At the time when Miss Prism left me in the hand-bag, had I
  • been christened already?
  • christening, had been lavished on you by your fond and doting parents.
  • given? Let me know the worst.
  • your father.
  • what the General's Christian name was. But I have no doubt he had one.
  • He was eccentric, I admit. But only in later years. And that was the
  • result of the Indian climate, and marriage, and indigestion, and other
  • things of that kind.
  • before I was a year old.
  • Aunt Augusta?
  • his domestic life. But I have no doubt his name would appear in any
  • military directory.
  • records should have been my constant study. [Rushes to bookcase and
  • tears the books out.] M. Generals . . . Mallam, Maxbohm, Magley, what
  • ghastly names they have--Markby, Migsby, Mobbs, Moncrieff! Lieutenant
  • 1840, Captain, Lieutenant-Colonel, Colonel, General 1869, Christian
  • names, Ernest John. [Puts book very quietly down and speaks quite
  • calmly.] I always told you, Gwendolen, my name was Ernest, didn't I?
  • Well, it is Ernest after all. I mean it naturally is Ernest.
  • I knew I had some particular reason for disliking the name.
  • have no other name!
  • that all his life he has been speaking nothing but the truth. Can you
  • forgive me?
  • triviality.
  • time in my life the vital Importance of Being Earnest.
  • TABLEAU
## [1] "Algernon."       "Lane."           "Jack."           "Cecily."        
## [5] "Gwendolen."      "Lady Bracknell." "Miss Prism."     "Chasuble."      
## [9] "Merriman."
## who
##       Algernon.         Cecily.       Chasuble.      Gwendolen. 
##             201             154              42             102 
##           Jack. Lady Bracknell.           Lane.       Merriman. 
##             219              84              21              17 
##     Miss Prism. 
##              41

Algernon and Jack get the most lines, more than ten times more than Merriman who has the fewest. If you were looking really closely you might have noticed the pattern didn’t pick up the line Jack and Algernon [Speaking together.] which you really should be counting as a line for both Jack and Algernon. One solution might be to look for these "Speaking together" lines, parse out the characters, and add to your counts.

5.2 A case study on case

5.2.1 Changing case to ease matching

A simple solution to working with strings in mixed case, is to simply transform them into all lower or all upper case. Depending on your choice, you can then specify your pattern in the same case.

For example, while looking for "cat" finds no matches in the following string,

  • Cat
  • CAT
  • cAt

transforming the string to lower case first ensures all variations match.

  • cat
  • cat
  • cat

See if you can find the catcidents that also involved dogs. You’ll see a new rebus function called whole_word(). The argument to whole_word() will only match if it occurs as a word on it’s own, for example whole_word("cat") will match cat in "The cat " and "cat." but not in `“caterpillar”.

## [1] "79yOf Fractured fingeR tRiPPED ovER cAT ANd fell to FlOOr lAst nIGHT AT HOME*"                                                               
## [2] "21 YOF REPORTS SUS LACERATION OF HER LEFT HAND WHEN SHE WAS OPENING A CAN OF CAT FOOD JUST PTA. DX HAND LACERATION%"                         
## [3] "87YOF TRIPPED OVER CAT, HIT LEG ON STEP. DX LOWER LEG CONTUSION "                                                                            
## [4] "bLUNT CHest trAUma, R/o RIb fX, R/O CartiLAgE InJ To RIB cAge; 32YOM walKiNG DOG, dog took OfF aFtER cAt,FelL,stRucK CHest oN STepS,hiT rIbS"
## [5] "42YOF TO ER FOR BACK PAIN AFTER PUTTING DOWN SOME CAT LITTER DX: BACK PAIN, SCIATICA"                                                        
## [6] "4YOf DOg jUst hAd PUpPieS, Cat TRIED 2 get PuPpIes, pT THru CaT dwn stA Irs, LoST foOTING & FELl down ~12 stePS; MInor hEaD iNJuRY"
  • bLUNT CHest trAUma, R/o RIb fX, R/O CartiLAgE InJ To RIB cAge; 32YOM walKiNG DOG, dog took OfF aFtER cAt,FelL,stRucK CHest oN STepS,hiT rIbS
  • 67 YO F WENT TO WALK DOG, IT STARTED TO CHASE CAT JERKED LEASH PULLED H ER OFF PATIO, FELL HURT ANKLES. DX BILATERAL ANKLE FRACTURES
  • PUSHING HER UTD WITH SHOTS DOG AWAY FROM THE CAT'S BOWL&BITTEN TO FINGE R>>PW/DOG BITE
  • DX R SH PN: 27YOF W/ R SH PN X 5D. STATES WAS YANK' BY HER DOG ON LEASH W DOG RAN AFTER CAT; WORSE' PN SINCE. FULL ROM BUT VERY PAINFUL TO MOVE
  • BLUNT CHEST TRAUMA, R/O RIB FX, R/O CARTILAGE INJ TO RIB CAGE; 32YOM WALKING DOG, DOG TOOK OFF AFTER CAT,FELL,STRUCK CHEST ON STEPS,HIT RIBS
  • 4YOF DOG JUST HAD PUPPIES, CAT TRIED 2 GET PUPPIES, PT THRU CAT DWN STA IRS, LOST FOOTING & FELL DOWN ~12 STEPS; MINOR HEAD INJURY
  • UNHELMETED 14YOF RIDING HER BIKE WITH HER DOG WHEN SHE SAW A CAT AND SW ERVED C/O HEAD/SHOULDER/ELBOW PAIN.DX: MINOR HEAD INJURY,LEFT SHOULDER
  • RT SHOULDER STRAIN.26YOF WAS WALKING DOG ON LEASH AND DOT SAW A CAT AND PULLED LEASH.
  • 67 YO F WENT TO WALK DOG, IT STARTED TO CHASE CAT JERKED LEASH PULLED H ER OFF PATIO, FELL HURT ANKLES. DX BILATERAL ANKLE FRACTURES
  • 46YOF TAKING DOG OUTSIDE, DOG BENT HER FINGERS BACK ON A DOOR. DOG JERK ED WHEN SAW CAT. HAND HOLDING LEASH CAUGHT ON DOOR JAMB/CT HAND
  • PUSHING HER UTD WITH SHOTS DOG AWAY FROM THE CAT'S BOWL&BITTEN TO FINGE R>>PW/DOG BITE
  • DX R SH PN: 27YOF W/ R SH PN X 5D. STATES WAS YANK' BY HER DOG ON LEASH W DOG RAN AFTER CAT; WORSE' PN SINCE. FULL ROM BUT VERY PAINFUL TO MOVE
  • 39YOF DOG PULLED HER DOWN THE STAIRS WHILE CHASING A CAT DX: RT ANKLE INJ
  • 44YOF WALKING DOG AND THE DOF TOOK OFF AFTER A CAT AND PULLED PT DOWN B Y THE LEASH STRAINED NECK
##  [1] "bLUNT CHest trAUma, R/o RIb fX, R/O CartiLAgE InJ To RIB cAge; 32YOM walKiNG DOG, dog took OfF aFtER cAt,FelL,stRucK CHest oN STepS,hiT rIbS"   
##  [2] "4YOf DOg jUst hAd PUpPieS, Cat TRIED 2 get PuPpIes, pT THru CaT dwn stA Irs, LoST foOTING & FELl down ~12 stePS; MInor hEaD iNJuRY"             
##  [3] "unhelmeted 14yof riding her bike with her dog when she saw a cat and sw erved c/o head/shoulder/elbow pain.dx: minor head injury,left shoulder" 
##  [4] "Rt Shoulder Strain.26Yof Was Walking Dog On Leash And Dot Saw A Cat And Pulled Leash."                                                          
##  [5] "67 YO F WENT TO WALK DOG, IT STARTED TO CHASE CAT JERKED LEASH PULLED H ER OFF PATIO, FELL HURT ANKLES. DX BILATERAL ANKLE FRACTURES"           
##  [6] "46yof taking dog outside, dog bent her fingers back on a door. dog jerk ed when saw cat. hand holding leash caught on door jamb/ct hand"        
##  [7] "PUSHING HER UTD WITH SHOTS DOG AWAY FROM THE CAT'S BOWL&BITTEN TO FINGE R>>PW/DOG BITE"                                                         
##  [8] "DX R SH PN: 27YOF W/ R SH PN X 5D. STATES WAS YANK' BY HER DOG ON LEASH W DOG RAN AFTER CAT; WORSE' PN SINCE. FULL ROM BUT VERY PAINFUL TO MOVE"
##  [9] "39Yof dog pulled her down the stairs while chasing a cat dx: rt ankle inj"                                                                      
## [10] "44Yof Walking Dog And The Dof Took Off After A Cat And Pulled Pt Down B Y The Leash Strained Neck"

5.2.2 Ignoring case when matching

Rather than transforming the input strings, another approach is to specify that the matching should be case insensitive. This is one of the options to the stringr regex() function.

Take our previous example,

  • Cat
  • CAT
  • cAt

To match the pattern cat in a case insensitive way, we wrap our pattern in regex() and specify the argument ignore_case = TRUE,

  • Cat
  • CAT
  • cAt

Notice that the matches retain their original case and any variant of cat matches.

  • 87YOF TRIPPED OVER CAT, HIT LEG ON STEP. DX LOWER LEG CONTUSION
  • 31 YOM SUSTAINED A CONTUSION OF A HAND BY TRIPPING ON CAT & FALLING ON STAIRS.
  • DX CALF STRAIN R CALF: 15YOF R CALF PN AFTER FALL ON CARPETED STEPS, TR YING TO STEP OVER CAT, TRIPPED ON STAIRS, HIT LEG
  • DISLOCATION TOE - 80 YO FEMALE REPORTS SHE FELL AT HOME - TRIPPED OVER THE CAT LITTER BOX & FELL STRIKING TOE ON DOOR JAMB - ALSO SHOULDER INJ
  • 73YOF-RADIUS FX-TRIPPED OVER CAT LITTER BOX-FELL-@ HOME
  • FOREHEAD LAC.46YOM TRIPPED OVER CAT AND FELL INTO A DOOR FRAME.
  • PT OPENING HER REFRIGERATOR AND TRIPPED OVER A CAT AND FELL ONTO SHOULD ER FRACTURED HUMERUS
## character(0)

5.2.3 Fixing case problems

Finally, you might want to transform strings to a common case. You’ve seen you can use str_to_upper() and str_to_lower(), but there is also str_to_title() which transforms to title case, in which every word starts with a capital letter.

This is another situation where stringi functions offer slightly more functionality than the stringr functions. The stringi function stri_trans_totitle() allows a specification of the type which, by default, is "word", resulting in title case, but can also be "sentence" to give sentence case: only the first word in each sentence is capitalized.

## 79yOf Fractured fingeR tRiPPED ovER cAT ANd fell to FlOOr lAst nIGHT AT HOME*
## 21 YOF REPORTS SUS LACERATION OF HER LEFT HAND WHEN SHE WAS OPENING A CAN OF CAT FOOD JUST PTA. DX HAND LACERATION%
## 87YOF TRIPPED OVER CAT, HIT LEG ON STEP. DX LOWER LEG CONTUSION 
## bLUNT CHest trAUma, R/o RIb fX, R/O CartiLAgE InJ To RIB cAge; 32YOM walKiNG DOG, dog took OfF aFtER cAt,FelL,stRucK CHest oN STepS,hiT rIbS
## 42YOF TO ER FOR BACK PAIN AFTER PUTTING DOWN SOME CAT LITTER DX: BACK PAIN, SCIATICA
## 79Yof Fractured Finger Tripped Over Cat And Fell To Floor Last Night At Home*
## 21 Yof Reports Sus Laceration Of Her Left Hand When She Was Opening A Can Of Cat Food Just Pta. Dx Hand Laceration%
## 87Yof Tripped Over Cat, Hit Leg On Step. Dx Lower Leg Contusion 
## Blunt Chest Trauma, R/O Rib Fx, R/O Cartilage Inj To Rib Cage; 32Yom Walking Dog, Dog Took Off After Cat,Fell,Struck Chest On Steps,Hit Ribs
## 42Yof To Er For Back Pain After Putting Down Some Cat Litter Dx: Back Pain, Sciatica
## 79Yof Fractured Finger Tripped Over Cat And Fell To Floor Last Night At Home*
## 21 Yof Reports Sus Laceration Of Her Left Hand When She Was Opening A Can Of Cat Food Just Pta. Dx Hand Laceration%
## 87Yof Tripped Over Cat, Hit Leg On Step. Dx Lower Leg Contusion 
## Blunt Chest Trauma, R/O Rib Fx, R/O Cartilage Inj To Rib Cage; 32Yom Walking Dog, Dog Took Off After Cat,Fell,Struck Chest On Steps,Hit Ribs
## 42Yof To Er For Back Pain After Putting Down Some Cat Litter Dx: Back Pain, Sciatica
## 79Yof fractured finger tripped over cat and fell to floor last night at home*
## 21 Yof reports sus laceration of her left hand when she was opening a can of cat food just pta. Dx hand laceration%
## 87Yof tripped over cat, hit leg on step. Dx lower leg contusion 
## Blunt chest trauma, r/o rib fx, r/o cartilage inj to rib cage; 32yom walking dog, dog took off after cat,fell,struck chest on steps,hit ribs
## 42Yof to er for back pain after putting down some cat litter dx: back pain, sciatica